Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJL114W
Systematic Name YJL114W
Strain S288c
Description Retrotransposon TYA Gag gene co-transcribed with TYB Pol; translated as TYA or TYA-TYB polyprotein; Gag is a nucleocapsid protein that is the structural constituent of virus-like particles (VLPs); similar to retroviral Gag
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL114W YJL114W
AGGAGGAAGAGAAGACTGAAGACAACGAAACGAATCTTGAAGAAGAGGAGGAAGACATAG
AAAATAGTGACGGCGATGAGGAAGAAGGAGAAGAAGAGGTGGGGTCTGTAGACAAGAATG
AAGATGGTAATGATAAGAAGAGGAGGAAAATAGAAGGGGGGTCCACGGATATTGAATCCA
CTCCAAAGGATGCGGCACGTTCAACGAATTAAGAATTTATGGGTTATAAGATTAATGGTA
CCTGCAAGAGAGGTACACTTTATAAAATGTATAAATAAAAAAATAACAGACATAAGATAA
AGTCGGGTTAGGGCAACAGCTACGTAAAAAATAAAAGGCAGTAATATTTTCCATTTAAGT
TGATTTTCTTATTATTGTCGTTGAGAACAAAAAGAAATTGGACGAGTCCGGAATCGAACC
GGAGACCTCTCCCATGCTAAGGGAGCGCGCTACCGACTACGCCACACGCCCTAATATTAT
TGATATTGTTGTTTATCAAAGTGAGATACGTCAGTATGACAATACGTCATCCTAAAAGTT
CATAAAACACATATGAAACAACTTCATAACAGAACGAACATGTTGGAATAAAAATCCACT
ATCGTCTATCAACTAATAGTTATATTATCATGTTGGAACGAGAGTAATTAATAGTGACAT
GAGTTGCTATGGTAACAATCTAATGCTTACATCGTATATTAATGTACAACTCGTATACGT
TTAAGTGTGATTGCGCCTATTGCAGAAGGAATGTTAAACGAGAAGCTCAGACAATACTGA
AGCTGTGTTAAAGACCTATTAGTTGAACATGTTATGGTAGGTACATATATGAGGAATATG
AGTCGTCACATCAATGTATAGTAACTACCGGAATCACTATTATATTGGTCATAATTAATA
TGACCAATCGGCGTGTGTTTTATATACCTCTCTTATTTAGTATAAGAAGATCAGTACTCA
CTTCTTCATTAATACTAATTTTTAACCTCTAATTATCAAC
Chr coordinates Chr X from 197915-198595
w3c xhtml validator w3c css validator