Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ASF1
Systematic Name YJL115W
Alias CIA1
Strain S288c
Description Nucleosome assembly factor, involved in chromatin assembly and disassembly, anti-silencing protein that causes derepression of silent loci when overexpressed; plays a role in regulating Ty1 transposition
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASF1 YJL115W
AAAAAATTTTTTTGCTCGATCTTCTATCCTCTTTAGGTTAATTGTCGCTGTTATTGTCTA
GATTTTTTCTCGGAGATGGCGCATCTATTTGCCGTCAAAAGATCCTCTCATACCATATTA
AGTAAATTGCCTCCATTTCTTTTTCCTCGGGCAGAGAAACTCGCAGGCAACTTGCTCTCG
AAGTGGTCACGTGCGGGTCTAGGCCTGCATAATCGGCCCTCACAGAGGGATCCCGTTACC
CATCTATGCTGAAGATTTATCATACTATTCCTCCGCTCGTTTCTTTTTTCAGTGAGGTGT
GTCGTGAAAGAAAACCCACAATTAAACTTTCAACAACCGGGCGACTAGGAAGAGAGTAGT
GGGCGCGGATGACGAAGGCTAAGGTCACTTCTTCGTTTCCTTTATTGGGGTTTCCGTGTA
GCCTTCCCCTGAATAGTGTGGGACGTTTTATGAGAAGCCGTAAGAAATAGGCAAATTGAG
TTATGACAAGTAGACATGATGCCGCAGCCTTGCCTGACTTTACGTCTCCTTCATGAATAA
GTTTTTCTATCGAGTTCTTTTCCTTTTTTCGCCTTAATTAGCTCAATTAAGCCTGTCCTC
ACTACTTTTCTTTTTCTTATCGGCTTTGTGCCACACCTAACCTTCGAATGCTGTTTTATT
CCGTTCTTACATGGGATGGTAATGCCTTGGCGAGAATTTCGATTTTCAGGATATTGTCTT
GGTGGCGTCTTTTGCTGTTACTATGTGTTTAAGAGAGAGCTGTTCTACAAAGAACTTTTC
ATTTACGCGTTTTTTCCTTTTTTTTTTTTTCTCATCCTAAACGCGTAAATCTGTTCCCTT
TTTCATGTAATGGGCGTACAACCGACGATGGAAAAATGAATCTTGCAATTTTAATACTAA
CACTTGGAATAACTCCAAACAGGTAAGAGGCTCACAGAATCTCGAAAGTGTAACAGCGTA
CTCTCCCTACCATCCAATTGAAACATAAGATATAGAAAAG
Chr coordinates Chr X from 196287-197126
w3c xhtml validator w3c css validator