Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DPI8
Systematic Name YJL133C-A
Strain S288c
Description Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DPI8 YJL133C-A
GCGAAAGCATATTCTTGGCAGACAGCGATTTCGCGTTGGCTGATTGTATTCGCGTCTTAA
GGGCATCTATCGGGAACATCACTGAATGTTCCATTATACCAGCAAATGCACCCGCTATAA
GTTGATGGTACAATGGCGCGTGGGTGGGGAGCGCCTCATAATCGGGTAGATCCATAGGTA
TTGCTGGAATTGGCCTTGTTGAATTATTACTCGACGAGTTTTCTACCATAATATCTTCTT
TTTTTATAACATAAATATATTTACAGCAAACCTTAAGAGGTGTTAACGAATATGGGAATC
GTGATTAATTAAGTGAAGTTACGATCCCAAGATAAAATAAGGAAGTTGTTGAAAGAGGAA
AGAATCGATGAAGAAATGAACGACAAAATTACTTTTGTCAATTGTAGGGTACGAAACACC
AAGAAATGCAATAAGTGCTATGTAAAGGTGATCCAGTCTTGGTTAGCACACACGCCCAGT
TTCTCGAGAGACATAATGACAGTAAACGGTGAGTATAAAAAAAAAGCAAAAAAAAAAGAA
AAAAGGAGCAATCGTTCGTTACAAACGATCTAGACTTGATGAAAAAAAACCCTAAAATGT
CTCAGACCTAAAACAAAACCCTAAGAAGCACGTGATACAAACCTGTCACGTGCAACATTA
TGGGGTATGGGTGTGTCACACATTTGAAAAAAAGTGGGCGGAACGTGTGTGGGGGGGTGT
CATGCCATTTCCACATTTGGTTGCTCTGGAGATAAGATCCACGAATGAAGGTGAGGGGCA
TGACTTCAGGGATCAATTTCCCGCCCGCAAGTTAGTTTTTCCGGTGGGAGCCGAGCATCA
AGCATGACCACTTCCTGGTGCAGAGAGAAAGTTTCACACATATAAAAGAATAAACCGAAA
GTAATGTAGGGAGATGTTTAATGTGATTTTTCACCTTTGTTTTAATGATTACGCACAAGT
TTAAATATTACATTCATAAGACAGTAAATAAACGTATTAA
Chr coordinates Chr X from 159847-159623
w3c xhtml validator w3c css validator