Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ROQ1
Systematic Name YJL144W
Strain S288c
Description Cytoplasmic hydrophilin with a role in dessication resistance; expression induced by osmotic stress, starvation and during stationary phase; GFP-fusion protein is induced by the DNA-damaging agent MMS
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ROQ1 YJL144W
ATGTTAAGGAGGGAAACTTCAACAATATACAGGACACACAAAAAAAGCAACAGTAGTATA
CTCAGGAGCCAGCGGGACCAGACTAGAGTGGATTCCTTGGTAGAGGAGTCTCCCATGGGC
GATTTCGGGATCAATAACCAGCCTACACAGCCTGGCGTGATATACTACTTTGTAGAGCTG
ACTAATTTAGGCATACAGGAAAACACAAGCAGTAATAATAACAACAACAATAATCATGGT
GACGATGAAAACGGCAGTCGATACGGCCACGGCAGCAGTCTGGGTGGAGACGTTCACTCT
CGCCGTTGTTCATGA
Promoter Sequence
Download FASTA
>ROQ1 YJL144W
CCTATCAATTTGAATATAGCACCATTGTACAGAACCTGATCGATATTTTGAATTGGAGGA
GGGAATTCAACCCATTGAGTTGTGCCTACAAGGAAGTCCATAATACAGAATTGCAAAACG
TTGGTATTTTGACATTCGATGCAAACGGCGACGCAAATAAAAAGGCTGTCACTTGGAACT
TATACGGCCAACTGGTCAAAAAAAAAGAATTGTTTCAAAATGTGGATAAGTTTGTACGCT
ACAGAATCGGGCTCATGGAAAAGGGTTTGAGCTTATTAGATTTCACCAGCTCCGACAACA
ACTATATGACCCAAGTCCACGATTATAAAGGCGTCTCCGTGTGGCGAATGGATTCTGACA
TTAAAAACTGTAGCAAGACGGTCATTGGAATCTTTCAAAAATACTATCCAGAACTGTTAT
ATGCAAAGTATTTTGTTAATGTCCCCACCGTTTTCGGCTGGGTTTACGATTTAATCAAAA
AGTTCGTTGACGAAACCACCAGAAAGAAGTTCGTGGTATTAACCGACGGCAGCAAGTTGG
GTCAATACTTGAAGGATTGCCCATATGAAGGGTATGGCGGGAAAGATAAGAAGAACAATC
TGACCAAGCAAAATGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAA
AACAAATCATCGAGGACGTTGAGTGATTTGTTGGCATGATCTAATAATAGTCTCTTATAT
AAACCCTATAATAATTTCTTATTTTTGCCTTATATTCAGGTAAATCACCATCTAACTGTA
TTATCTCTCACGTATCTTCACTTATATGGCTCAGAAAACACCGTACGAAACGAAGGGGCT
GCGAAAATGTTTCTAGAAGGTAATGGCAATAATAGGGATACAGATCGATCAGATCCGCCT
ATATAAAAGACAACGCACCGAAGGTGAACAAGATCGCAGATAAAGGTATTTACAAGGGAA
AAAAGTCAGCAAAAACAAGAGATAAGATAACAAGAAGAAG
Chr coordinates Chr X from 146359-146673
w3c xhtml validator w3c css validator