Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name INO1
Systematic Name YJL153C
Alias APR1
Strain S288c
Description Inositol-3-phosphate synthase, involved in synthesis of inositol phosphates and inositol-containing phospholipids; transcription is coregulated with other phospholipid biosynthetic genes by Ino2p and Ino4p, which bind the UASINO DNA element
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>INO1 YJL153C
TTCTTTTTTTTTTTTTTTTTTTCTTTTTGGGAACGGGGGAAAAGGTCTCACTAGTATATA
AAGGAAAGAGAGTACAGCACGAATGAGCCAGCTGCAGGAAAGGGGCTAGGTTAAAAAATA
AAAACCCAGCAGAAAGCAAACAACCAAATATAATTTAGAAATGGACAGAGACCATATTAA
TGACCATGACCATCGAATGAGCTATTCCATCAACAAGGACGACTTGTTGTTAATGGTTTT
GGCGGTTTTCATTCCCCCAGTGGCCGTCTGGAAGCGTAAGGGTATGTTCAACAGGGATAC
ACTATTGAACTTACTTCTCTTCCTACTGTTATTCTTCCCAGCAATCATTCACGCTTGCTA
CGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGACTGC
GCCCGCCGTAGACCGTGACCTGGAAGCTCACCCTGCAGAGGAATCTCAAGCACAGCCTCC
AGCATATGATGAAGACGATGAGGCCGGTGCCGATGTGCCCTTGATGGACAACAAACAACA
GCTCTCTTCCGGCCGTACTTAGTGATCGGAACGAGCTCTTTATCACCGTAGTTCTAAATA
ACACATAGAGTAAATTATTGCCTTTTTCTTCGTTCCTTTTGTTCTTCACGTCCTTTTTAT
GAAATACGTGCCGGTGTTCCGGGGTTGGATGCGGAATCGAAAGTGTTGAATGTGAAATAT
GCGGAGGCCAAGTATGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTT
TATCTTCATCCTTCTTTCCCAGAATATTGAACTTATTTAATTCACATGGAGCAGAGAAAG
CGCACCTCTGCGTTGGCGGCAATGTTAATTTGAGACGTATATAAATTGGAGCTTTCGTCA
CCTTTTTTTGGCTTGTTCTGTTGTCGGGTTCCTAATGTTAGTTTTATCCTTGATTTATTC
TGTTTCATTCCCTTTTTTTTCCAGTGAAAAAGAAGTAACA
Chr coordinates Chr X from 135933-134332
w3c xhtml validator w3c css validator