Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CIS3
Systematic Name YJL158C
Alias CCW11, CCW5, PIR4, SCW8
Strain S288c
Description Mannose-containing glycoprotein constituent of the cell wall; member of the PIR (proteins with internal repeats) family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIS3 YJL158C
AAACGCGTCTAATTATGGATGAACACCCGCATTCTAGTTTGATAGAAATAGAATATTTTG
ACCTGGTAAAGCAGCAAAGAATTCATCAGACCCTGGAAGTTCCCAACCTCTAGTAGTTCG
GGAATCGAGGCCCGTATTTCGAGGCTTTTGCTTTTCCTTTTTTTTTTTTCGTTTCTCCAC
GTCTATACTACGCAATGACTGAATATATATAATGCGTCGTAAATAGCAGTTAATGTATAA
ATAGAAATTGAGTAAACTTTAATTTTGCCTAAGAAAGAACCTATTGGCGATAATTAAATC
TCGTCATATATGCACTATATATTTTTTTTCGTTTGGCGTTGTTTATCTATTTCCCGAACG
GGATTATTTCCCTGAATTAGTTCATAATGAAAAAAACTCGCAGCCGGGTAACCCTCTTCG
TACCAAAAATGCACGTGTCTGTACACAATTATACCAACATGGTTGTAGCATTTCAAGTTA
GCTTGTTCGAGCTGTATAGTAAAAGAAACGTCGATGTGGCTAATTTGTTCCGGTGACTTT
CAGGTCACGTGTTTTCCATGCGTGCGTTGCTTCTTCCTGCAAATCCACGGCTCGTAAAAG
AGGACAATCAGCTTTTTTCCGTGGTGCCTGGCCGGGCCGCCTATGCATTCCATACGATTT
CCACGGGCCAGATCCCGCCTAGCCCTTCCAGCTTTTCTTTTTCCCCTTTTGCTACGGTCG
AGACACGGTCGCCCAAAAGAAACGGGTCAGCGTGTACTGCGCCAAAAAAATTCGCGCCGA
TTTAAGCTAAACGTCCACAAACAAAAACAAAAATAAGAAATAGGTTGACAGTGGGTGAAA
AATTCTCGAAGGTTTCATCTCCAAACAGTCAGTATATAAGTATTCGGGAAAGAGAGCCAA
TCTATCTTGTGGTGGGTCTATCTTAACCTTCTCTTTTTGGCAGTAGTAATTGTAAATCAA
GACACATAAAACTATTTCACTCGCTAAACTTACATCTAAA
Chr coordinates Chr X from 122948-122265
w3c xhtml validator w3c css validator