Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TPK1
Systematic Name YJL164C
Alias PKA1, SRA3
Strain S288c
Description cAMP-dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras-cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TPK1 YJL164C
TCATATCGATACTGGGTATCGGAAGAGGTGTTGTGTTACTGGTCGTATCACCTACATTAC
TGTACACGCTAAAGAGGATTTATCAACACTTGAACCATTCGATAGACAAGATAGACATCT
TTTGCATACAGTTTTCTATGATTGTTATAACACTGAGTCTCTTTGTCATGATACGATTTG
GCGAGAAAACTCCCACATCCATGATAATATTCGCTCTTTTACAGGCATTGAGCGCGTTTT
GTTCACCAACTTTGCAGTCTGGTATCATAAAGTACACCTCTAAGAAACATACAGGCGAGA
TGTTCGGAGCAATGGCTTTGGTAAGGTCCTGTGTTATGCTTGTCATCCCTCCCATCCTCC
TTAAGCTATATGGAAGTACTGTCTCCGTTAATCCTAGTCTGTTTATGTATATACCGTTCT
CAACAAGTATTGTTGCCATCTTGTTGACATTCTTCCTAAGAATTTACAAGAACCCTCCGC
TGGACGGGCCTTAAAAACATTTACATACCGTATACACCACATATTTTTAGTTACTTGTTC
GAAGCTGTGCTGCTATTCGTTCTTGCAAAGCCAGTGTCCTAACGACTTTGCTTATGACAT
GATTCAACATAGTGTTGTTGTGGTTTTTTCTACGTAATCATGATGATCTTTTTTTTCGCG
CTATTAGGGGGGAGGGAAGGCGGGATCTGGTAAAAGTTTGACATAATAATCAAGGGGGAT
ATCGTATCCCTTTACTTGAAAACTTGAAAAATATTCATCTACTATCTCTGGCCAGAAAAA
CGTGAGAATTTTTAGGTGCGAAACATCATAGAAGCTGCGATTGTATCCATCTAAGAGTTT
TAATTTGATAAAGCTAAGGAATCTGACCCTATACTTTTTTTTTTGTTTGGCTTGCTTGCA
TTTTCAATCGGCTTCAAAGGTAGCACAGAAAGTAGTGTTCTCTTAGCTTAAGCAGTGCAT
GAATTATAGCTGATTGTGTGAAAGAATCTTTTTTTTGGGT
Chr coordinates Chr X from 111159-109966
w3c xhtml validator w3c css validator