Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ASG7
Systematic Name YJL170C
Strain S288c
Description Protein that regulates signaling from a G protein beta subunit Ste4p and its relocalization within the cell; specific to a-cells and induced by alpha-factor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASG7 YJL170C
GAAACAAAAAAGACTGGAATACGAAAGAATTGCGCTAGAAAGAGCCAAACAAGAAGAATT
GGAAAGCCTGAAGCAAAAGCTAAAGCTTGAGAATGAAAGAAAAAGCGTTTTGGAGGATAT
TATAGCGGAGGCCAACAAACAGAAGGAGTTACAAAAGGAAGAGGCCAAAAAACTAGTGGA
AGCAAAAGAGGCTAAGCGGTTGAAAAGAAAAACGGTCTCCCAGTCCCAAAGACTAGAGCA
CAACTGGAATAAATTCTTTGCATCTTTTGTACCCAACTTAATAAAAAAAAACCCACAAAG
TAAACAATTTGATCATGAAAACATTAAACAATGTGCTAAAGACATCGTGAAAATCCTAAC
TACAAAGGAACTTAAAAAAGATTCTTCAAGAGCGCCGCCTGATGACTTAACCAAAGGAAA
AAGGCATAAAGTTAAAGAATTCATAAATTCATACATGGATAAGATTATCCTCAAGAAGAA
GCAAAAAAAGGCGTTGGCATTATCATCAGCATCAACAAGGATGTCTTCTCCTCCACCTTC
AACATCATCATAATTAACCAGACATGCATATTTGGGGCTTGTTTCACGTTTTCTGTCCCA
AAGGAAGTCTTGTACTTTAATTGTAATTGCGATTTGTAATAAGTAATTTTTTTTGTCTTT
ACCGTTTATTTCTTTATACATTTTTGGTGCATATATTTAAATATCCGCATTAGTGGGCTA
TCAGTAGCACTGTAATGATAGGTAATGTGACACATCTTCTCGACAGATATTATTCTTGAA
AAAATCGTGCGTTTCAAGTGTCTTTATTTTTTTGCTGTCAATAGAAGTGTTGAAATGACT
TTGAAACGTAATTACCGCATCGGGAAATTTACATGTTAACTGCAATGAAAACAAGGAATA
TACGGGGAACATATAAAGGGTCAGCGTCGTTGACTAGTCTGTCATTTATATTGTGCTTGT
ACATAGGACTACAAAAATTCAAAGAATGACGACAAGAAAC
Chr coordinates Chr X from 101779-101150
w3c xhtml validator w3c css validator