Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPS1
Systematic Name YJL172W
Strain S288c
Description Vacuolar carboxypeptidase yscS; expression is induced under low-nitrogen conditions
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>CPS1 YJL172W
ATGATCGCCTTACCAGTAGAGAAGGCCCCTAGAAAGTCCCTATGGCAAAGGCACAGAGCC
TTTATTAGTGGAATAGTTGCCCTTATTATCATCGGCACCTTCTTCCTCACTTCGGGTCTC
CACCCAGCACCACCTCATGAGGCAAAGCGTCCACACCATGGAAAAGGTCCCATGCACTCA
CCCAAATGTGAGAAGATTGAACCATTAAGTCCATCATTCAAACATTCCGTCGACACAATT
CTTCATGACCCTGCCTTTAGAAACAGCTCCATTGAGAAACTGTCCAATGCTGTTAGAATC
CCCACTGTAGTCCAAGACAAAAACCCCAACCCCGCAGATGATCCGGATTTCTATAAGCAT
TTTTATGAACTACACGACTATTTTGAGAAGACTTTCCCTAATATTCACAAGCATTTGAAA
TTGGAGAAAGTCAATGAGCTGGGTCTTCTATACACATGGGAAGGTTCTGATCCTGATCTA
AAACCATTATTGTTAATGGCCCATCAAGATGTTGTACCTGTAAACAACGAAACTTTATCA
TCCTGGAAGTTCCCTCCATTTTCTGGTCACTATGATCCAGAAACAGATTTTGTTTGGGGG
CGTGGTTCTAACGATTGTAAGAACTTGTTAATTGCCGAGTTTGAAGCTATCGAACAACTG
TTGATAGATGGATTCAAGCCCAACAGAACTATTGTTATGTCGCTTGGTTTTGATGAAGAA
GCAAGCGGCACCCTCGGTGCTGCCAGCTTAGCCTCATTTCTTCACGAAAGATATGGTGAT
GATGGTATTTACAGTATCATTGACGAGGGTGAAGGTATCATGGAAGTCGACAAGGATGTC
TTTGTTGCCACTCCAATCAACGCTGAAAAAGGCTATGTCGACTTCGAAGTCAGTATTCTA
GGCCATGGTGGTCATTCCTCTGTCCCACCTGATCATACCACAATCGGTATCGCTTCAGAA
CTGATTACTGAATTTGAAGCCAACCCATTTGACTACGAATTTGAGTTTGACAATCCAATC
TATGGATTGTTGACATGTGCTGCTGAACATTCTAAATCTTTAAGTAAGGATGTGAAGAAG
ACAATTTTGGGCGCACCATTCTGTCCTAGAAGGAAGGACAAGCTTGTTGAGTACATTTCC
AACCAATCACATTTGCGCAGCTTAATAAGAACAACACAAGCTGTTGATATCATCAATGGT
GGTGTTAAAGCTAATGCTCTGCCCGAAACTACCAGATTCTTGATCAATCACAGAATTAAT
TTACATTCTTCTGTGGCTGAAGTCTTTGAAAGAAACATAGAATATGCGAAAAAGATTGCT
GAGAAGTATGGCTATGGTTTATCTAAGAACGGTGACGATTACATTATCCCTGAAACCGAG
TTAGGTCACATTGACATTACTCTCTTGAGAGAATTGGAACCAGCACCACTTTCGCCAAGT
TCAGGCCCTGTTTGGGACATTTTGGCAGGTACTATTCAAGATGTTTTTGAAAACGGTGTT
CTACAAAACAACGAAGAGTTCTATGTGACTACTGGTTTATTCTCTGGTAACACCGATACT
AAATACTACTGGAATTTGTCCAAGAACATTTATAGGTTTGTTGGCTCTATCATTGATATT
GATTTACTGAAGACATTGCATTCGGTTAATGAACACGTGGATGTCCCAGGTCATTTATCT
GCCATTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAA
Promoter Sequence
Download FASTA
>CPS1 YJL172W
CGTTAGTCAACGACTGTTGGCTGTCATCTGTTCTTGTTGGGTGCTTGCAGCTGCATCGAC
AAACATGGATGGATGCCTCTACATATATATATATATTTATGTAATGGACCTCTGAATATT
TTACTATGTAACTGACTATAGGAGATACCACTGGTGCTGTAGTACAATTTAGCACTTGCA
AGCGTTGACACAGTTGTTGCGAAGGCCTCTTTCTTGTAGCACTTAATTGGAGTATGACTG
CCATCATGTAGGGAAATTATGAAAGCATAGGATCAATCTTGACGTTGCAAAGAAGAAGAG
ACTTGCTGTTCCCTATTGATCACTTACCGTTATTGGAGTTCATATGGTACTTTTTTCATA
ATTTTACGAGTAATCCCTAGTGGTAGTTAATATTCAGCAAATAAAATACCAGTTTGAGAC
CAAAGGTAAGATAAGAGTTTACTGATAAAGACAAAGAATTGGGATGACCTAGTCCAAGGG
ATTATAGTACCTTCGCGAGTATTGCATATAAGCTTTTAGCGATACACAAACAAAGCGACA
CCGGGATTTGCATATCGCTTGTTCCTACGACGTTGTCAGTTCCATAACCTCTGATTTCCC
ATACGGATTTTGAAAATCAGCTACGAATAGATAGTCTTTTTCTATTTTCAGTAAATGTGT
CATTGAAAAAAGTTTCTTTAGAACGACGCTTTTTGCAGGCTACTAGAAACACCCACTTCT
AGTAGCTTTACGTGACGAATTGAACCGCGTGATCTTGTGCACTGTTATCCTAAATGCTCA
ATGCTCAGAACATCTTCTTGTTATCTCAGCCTCGCCACCCTTATCTTATCATAGCGGCCT
TTTATTTTCCCCTTTGGGCAAAATACGATACAGCCTTCCAAGGTCGGGCAAGAAAGTTTA
TGACATATAAAAGAAACGGGTACCCCAAATACGTCTCTTCCCATTGTAAAACTAATCCTG
CATCATCACATTAAGGAATCATTCATCTAACAATTACATT
Chr coordinates Chr X from 97737-99467
w3c xhtml validator w3c css validator