Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KRE9
Systematic Name YJL174W
Strain S288c
Description Glycoprotein involved in cell wall beta-glucan assembly; null mutation leads to severe growth defects, aberrant multibudded morphology, and mating defects
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KRE9 YJL174W
CCTTAATAGCAGGCTTATTGTTTTCATTGTCTACCGGGTTCGTAGGTATACTAGGAGTGT
TTGCCTCATTGTTCGAAACAGAACTCTCGGTTTCGCCAAAGAGATTATCACTATCCTCAT
TATCTTGGCCAAAGACGTTCTGGGCCCTGCTTTCTTCTGTAGAAGGTGTTTCCTGGGAAT
CTAGCTTATTCGCTTGCATAGTCGGCTGCTGCTTTGCCGTTACCGTTATCGCCTCACTTT
CTGCATCGCGTGTGTTCGGAACAGTTGCTTCATCCTTCAGAGACTCATCTTGTTGCTGCG
ATTCTTCACCAGCAGTATCTGTATTGGCAACCCCTGCCACAGCTGCATTAGCGTTGCTAT
CACTATTGTTGTCATTGCCATGTTGGTCCACGTCCACGGAAGCGTTTACCGTGGACCCCT
CACCCAGTGTATTCTCCATGCTTGCAAACCGTATCACAATTGGTCTCTGAACGCGCCTCG
ATGTACCAATATATCGCGCCTTGCATGGCCTTTACACATTCCTCTTGCGTATCTGATATA
GTTTGTTTTCGTCTTTTCGCCAATGGCCTAAACGCCAAACGTCCGGCCTCGTTATTCGTG
ATGCCTACTTAATGGCTCTTAAATCGAATTTAAACTAGCTCAAAAGTAATCAATTCAAAC
TAAAATAACATCATTGGCCATCCTGAATTGTTGGATGCCATCTAAACTGCGTATTGACCA
TTATTCCATCGTAACCACGGCGGTTCAATATAATATCACTTTTGACGATTAGGTGTTTTA
TTTACATTTCTTTTTTTTTTTCCTCGAAAAAGATCTTCAAGGATAATACAGGAATAGAAC
AGGAGTCTCAAAGCATTCTTGAAGCCAGATTTGCTCCAGTTTGATAGTTCCAAGAAGCGC
TAAAAGTGGCAGTTCACACTTTGTTTTGATTACTAGGAATCTACTCTTTCGCTTTTTACT
TCCTTCTCAGAGAATCAGCAACTGTGACATATTATAGATA
Chr coordinates Chr X from 95092-95922
w3c xhtml validator w3c css validator