Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ELO1
Systematic Name YJL196C
Strain S288c
Description Elongase I, medium-chain acyl elongase, catalyzes carboxy-terminal elongation of unsaturated C12-C16 fatty acyl-CoAs to C16-C18 fatty acids
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ELO1 YJL196C
AGTTCGGATTCGTATGTCTCAGCACGTCCTTCGAGCGTGGCGTGGAGAGCGACAATGGGA
GGGACTGGAACTTCTGTCTTATAATCATATCAAGCTGGGCAGTCTTGCCAGTGCCAGGCG
GACCCGTGATGTACAGTGAATCGGACCTGTGTTCAGAAATTGCCTTCGCCAAAAAATTCA
TAACTTGTTCGTACTCTGCTGTTCTTGCTGGCAATGCACCATCGCTGCTATTCAAGTTGA
CTAGCTCAGATGACTTCTGCAAAAGTGCCTTTGTCCTCAAAAAAATAGACTGTGAGCCAA
ACTGCAGTTTTTCTGGGGATGATTCTGGTGTAACATCTGTGAACTGCAACTTTTTTCTTT
TCAAAGGTCGTGGAGGCGTTGCTGGAGCATCGTCAAATAGATTTCTTCTGATACGCTTAG
TTGGAGTTATTGGTATAGCTGACATGAACGTATATGGTACTATTGATGAAAATAGTGCAG
CGCAGTGTTCTGAATATTCCAAAATTGTTCTTCCAGAGAATATACCTCTACTATATAAAT
GAAAAAATAGACTAACTAATACTATTTTTCAAGATGGCGTTATATCTTTTCTGCCAGCCA
ACTCAATTTCCTAAGTGGGTAATTTCCTGATCTGGAAACTCCGACGCGTGAGGCCTCGCG
TCGCTTTCTTCTTTGGGTAATTCAGGGAAAACAAAGGAATGCAGACTAGCAACTAGTTTC
AAAACACAACAAATCGCAAGCCAGACATATTTTGTTGAAACTACAGATATTTCTGCTGCT
TTTATTACCTTGCACTTACGTGACGTGACGAAATATTAGTTCTAAACTCAGGGTCTTGGC
TTACCCGCGTCGGCTTTACGGATTAGTAAACCGAAGGACATAAGGGAAAGAAAGGAAGCC
AGAAAAAGAGGTAGAAGTATATAAGACTAACTGATATGAATATTAAGGTAGGATACCTTA
TCAATTTTAAGGAACTTGAGAGCTAAATTTGCAAGCAAGT
Chr coordinates Chr X from 68782-67850
w3c xhtml validator w3c css validator