Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OPT1
Systematic Name YJL212C
Alias GSH11, HGT1
Strain S288c
Description Proton-coupled oligopeptide transporter of the plasma membrane; also transports glutathione and phytochelatin; member of the OPT family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OPT1 YJL212C
GCTTCAGCCACATCATCTGGTTCCCACAGTGCGGCCCATTAAAAATAATATGTGTGATCT
TCTTCCACACGTACCCTGCCAAGACAGTGACGACATACAAGGTGCGTTTCCTGCACTGAA
AAACCACGCCACTGAGTGCGGATCCATACGTACAGCTAGAGCCATAGTGTGGCAGGAACC
TCGTCGCGCACATAAACACAACTGTGTTCAGTGCCAACTCCCATTCCTCTTTGTGTTCAC
TCGTATTGAATGCTGCATTGAACTCGGACCAAAACTGTCCATACAATTCTTTATCAAGCG
CTATCGAGTCGAGCTGTGCAACTCGAGACATGCTGCGTTGCCTTTAGATTACGTCTTCTC
AGTTATCTCGGCAATCTCTCCTCGTTATGCTTTCCCTCCGTCTTCACTCATCCCTTATAA
TGCGTTTCCCAGCAACCTTATCGATAGAATGGAGGGGAAATCGCATCCGTTCCACTCCTC
GGATCGATACTAACTTCCGAGACGTTGCATCAAAGGCCAAGACATGGCATTAGTCACCCT
TGTTGCAACGATAGACGCATACTACGGACCCCTCAAACCTCCCTACCTGCCCGTCGCTAT
CGCATTAATTTTCTTTTTTTCCACTATTTTTCCGGCCCGCCACACCTCCGACTACAAGAC
GCCACATCTACGTTTTGTCACACAAAATCCAGGACAATAGCCGTCTGCAAGGCACCAAGG
TTTTCAGCAGTTGCTTGTTGCTGCTGCCTGTTAATCACATCAAACCCACTGCAAGGGCAG
TCGATGGGTCTGTAAACGCCTTAGCAATCGTTGTTGAAGAAAGAGAGCTCTTATCATCAT
GGGGTGCCCATCATTTTTCTTTTTTTTTCAAATTTTGGGCTATTCAATGAATTGTTTCGA
CTATATATGGACAATCATCGGAAGCTGTGTATTCTTGGTAAAAAGTTTTCGACTGTGTGG
CAGAAAATAACCGCAACAATTATATAACGTCACAGAACAC
Chr coordinates Chr X from 36249-33850
w3c xhtml validator w3c css validator