Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMA5
Systematic Name YJL216C
Strain S288c
Description Alpha-glucosidase with specificity for isomaltose, maltose, and palatinose; member of the IMA isomaltase family; not required for isomaltose utilization, but Ima5p overexpression allows the ima1 null mutant to grow on isomaltose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMA5 YJL216C
GAAACAGTAGCATAGGCTGAAGCAGGCTTTTCTGGAACAACAACTTCCTCTGCCTCTTCC
CCATTATACTCGGAAAAGTCCTTGTTTTCCTCCACTGTAGGTACTGACAGATGTGAAGAA
TTTTCTATCGAAGGGCAGCCATCATCTTCTGCCTCTTCGAAAATCGGTTCTTCTGGCAAG
TTGGTTTTACGATCAGTCATGGTTTTTGCTGGCGTTCTGAGCTAACTAAAAGTGACTTAT
AAAAAATGCAATCTAAAATAAGAATGAAACAAAAATGGTCGTTTAAATATATCTAGTCAA
GCTTCATCCCTTACAATGGTTAGCGATGATATTCCGTCGTCCAAAAGATTACGACCATGC
CAGTTCATATTATTTTACTTAAGAGTTCATGTCTTTCATGCGAAGAAGCGTTCGGAAATT
CCAAAACTTCTTAGAGTTCAGGAACAGGCCCGGTCGCGGAATTATTCTCGGGATAATTCC
AGCCGCTTGGCAGGTAGGCTAAATTACACATTTCAAGAACTTTCTCCGGCCTTTTCTGTG
AGATACGTTTATAAGTTGCTGCAGCAGGATGCTCTAGGCTGCTTTCTCTGGAATTTCTCT
CCTTCTCCACATACCTCGTTGTTGAATCCCCGCGGAGGTGATATAATAAAGTTGCGTGAA
AGCGTAAATGCCTAGACGGAGAAAAGAAAACGGGGAAATAAACTTTGCATTATTTTTCCT
CCGTGGAGAATCCTCGGAGAAACACGGGAATATTTGAAACTATTTGCAACATTGTCCATT
GAAATAGTCACAATCCTAGAAGCTAATTCACCGGAAAAAGTAATTCACACTTAAGAATTG
TATCTTCCATTACCGCTACGGTAATTGATACGGTTTTGAGGAGTAAGTTCATAAACGTCT
GACGAATTATAAATTAGGACACTTGTTCACATATCTTGGTGCGAAAAACTACTGTTTCTT
GATGACTATATAGAAAGTGCTCAATATTGAAAAGAAAAAC
Chr coordinates Chr X from 26086-24341
w3c xhtml validator w3c css validator