Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJL218W
Systematic Name YJL218W
Alias acetyltransferase
Strain S288c
Description Putative protein of unknown function, similar to bacterial galactoside O-acetyltransferases; induced by oleate in an OAF1/PIP2-dependent manner; promoter contains an oleate response element consensus sequence; non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJL218W YJL218W
GGTTATGTATTCTTAGGCTGTCTGGTTTTTGCATACTTTTATGTCTTTTTCTTTGTCCCA
GAAACAAAAGGCCTGACGCTGGAGGAGGTGAATACTATGTGGCTGGAAGGTGTGCCAGCA
TGGAAATCAGCCTCATGGGTGCCACCAGAAAGAAGAACCGCAGATTACGATGCTGACGCC
ATAGACCATGACGATAGACCAATCTACAAGAGGTTCTTTTCCAGCTAATCTTCCGGTTTT
TAGTAACTGGAAAAAAATACATGAACTTAATTATTTATTATATACAATATTTACTTTTTT
ACGCCTTAATCCTTAACGGACTATTTGTTATGCCTTATAGAACTAGAAATTATATGATAA
ACATGAGCTACACGAGTTGACAGGGTGAACAGATTACTATAGCATCTTTCTCTCATGAAT
AATTTTTAAAATGTATAAATTTTGTAACGTTCCGAAGGGTGGAGTGAAATTCCATTCAAG
AAACCAAGCATTGAGACAGAACAGTACAGAGTTCAGTTGTTGCGGACCGAGAATTGTAAC
AAGTAGCCCCAGAAACATTCATATGACGTCTGTTTCAAATTAAGCTTAGTAAAAGTACAC
ATTTACCATAAAAAAATAGTACCAAGTCGGTGGCCTGATATCCTTATTTTCCTTCTGCCA
ATTGGGCAAGTTGGTACTAATATTTTAGGTGACACTGCCACTTTATTGTTATGGATTGAA
ATTTCTTAAATGTTCTCACAATCGGCCATAACGCTATTTCTCCGACGTAACCTCCTGTCA
TAGTGTGCCGTGCCTGAATAACTTAAAAAATTAAAGTTTTCAATGTGCCCAAAAAAATTC
ACAAATAGTACGCGCTCGTTAAACACCCTGTGACGCTGGGCCAGGCACTATTTAGCATTA
CTTCGAAAAGACGCAAGTATAAAGAGTGAGATCTCACGTACTACAACAAGAACATAGAGA
AGCATTCTAATAAGCATATAAACAAGGCTTCTAGAGAAAA
Chr coordinates Chr X from 21973-22563
w3c xhtml validator w3c css validator