Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMA4
Systematic Name YJL221C
Alias FSP2
Strain S288c
Description Alpha-glucosidase with broad substrate specificity for alpha-1,4- and alpha-1,6-glucosides; member of IMA isomaltase family; not required for isomaltose utilization, but Ima4p overexpression allows the ima1 null mutant to grow on isomaltose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMA4 YJL221C
TGGATAAATCATTTGCGGATGTATTATTAACACCGGACATGATATTGGGTAAGATACGAA
AGCTTTTAGTACTCAATTGTGCAATGATTATTTTTTCCAACTCATACCAAAAAAAGAAGA
AGAAAAAGATAGGAACAACAGTGTTCTTTAGTTACACAGCTGTGACATTATATACCTTTA
TTTAGCGAAAAAGAGGAACTGAGAAAGATGAGCCTAGACCTTAAGAGCTAAGTAGTATAG
GGTGTGTCGAACTGCTACTGATACTTTGAACGAAGGTGTCCGAGTGTATGCATTGCTCGT
GTGGTCAGCATTTTTATTGTGGAGGAGGCGGATTCATCTACAATTTCCGACGCCTGATTT
TCCACGGATATAATTTATTTTTTGACACCTGGAGTTTACATTTCACAAAATTTCTTTCTT
TTTAGTTTTGCACTGATTTCCCCTGAAATAAAGAAAAAAGAAAAAGAAGGTTTTGTGAAG
TGTCAGGGAAATGCACGAGAAAAGCACTTATAACTCGCACGGAGAAATGATTATGTAATT
TTCCCGGAGAAATGATTATGTAATTCCGCGGAGAAATGGTTATGTAATTGTTGCGGGGAT
CGAGGGTTGTTTACGCTCCGTATTTTGTCTTAGGGCTATGTATACGCAAGGCTGCGGAGG
CAATGCAATAATGGGGTCTGCTTGCAGATGGTATAATCTGCTATAACGGGCCAAGTGACA
GGCACGCTGTTGCAGAACATACCATCTTATATCATGTAGGTTGTGCAAACATTACCTAAA
ACTGAAAGCTTCGTTTACATACAGCACTCCTTCCAGATCCTAAATTTACTTTGTTCTTTT
CTTATTTTCGATCATTCGTAAGACGTCCACAGACATATATAAGTAAGGAAGACTTCTTCA
CTCGAGGAATTAGCTGTACTAGAATATATGTTCCATTCACCAATCCAAACACACAAACAA
AAGTGAAAGTTTTTTCATAGAGATAAGAAAGCAACGTACA
Chr coordinates Chr X from 18536-16767
w3c xhtml validator w3c css validator