Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MPP10
Systematic Name YJR002W
Strain S288c
Description Component of the SSU processome and 90S preribosome, required for pre-18S rRNA processing, interacts with and controls the stability of Imp3p and Imp4p, essential for viability; similar to human Mpp10p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MPP10 YJR002W
GAACTGTGCTAGTCATTTGCTGCTGCGGACTATACAAGTCGTCTTCTCCAGGTTCATTAG
TTAATCCGATGGAAACGAGCATGTGGCCGATAGATCTAAAGCATCTCTGTTTATCTATAG
GTTTATTGAGTGCCTGCTGGGGAGGACATGCGGTTTTTCCCAACTTAAAGACAGATATGA
GGCATCCAGATAAATTTAAAGACTGTTTGAAAACTACCTATAAGATAACATCGGTTACGG
ACATAGGTACTGCAGTTATTGGCTTTTTGATGTTTGGAAATCTTGTTAAAGATGAAATTA
CTAAGAACGTTTTGCTGACGGAGGGATATCCAAAATTCGTTTATGGTCTGATTTCAGCGC
TTATGACTATCATTCCTATCGCAAAGACCCCATTGAACGCAAGACCTATCGTTTCTGTAT
TGGACGTTCTGATGAATGTGCAACACATAGATGAAGCGGCCAGCGCCATAAAAAGAAGAG
CTGCGAAAGGCCTTCAAGTATTCAATAGGATCTTTATTAATGTTGTCTTCGTTTTGATAG
CTATTAATTTCCCTGAATTTGATAAGATTATCGCATTTCTGGGGGCCGGTTTGTGTTTTA
CAATTTGCCTAATTTTGCCGTGTTGGTTCTATTTAAGATTGTGCAAGACAACAATCAAAC
CATGGGAGAGAGTGGCTTGTCACGTAACCATATGTATTAGTGTCGTGTTGTCCACATTAG
GTGTTGGTGCTGCAATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAAATTC
ATTTACATTAGCTCTGTACTTCTGATAATGAAAAACCATTGCGTAATATACATATTTTCG
TGTAGAATTATTTCCATAAAATATTCACCGCCTTTTCTGTACTGGCCGCCGGCATGCGAG
GGAAGCAGAAAATTTTCAATTTTGCGATGAGCTCTTGAAGAAACAGTGTTTTGTTATGAA
TAAATGATGTGTGCACGAAAGACCCAAGGAAAGTCGTATA
Chr coordinates Chr X from 438865-440646
w3c xhtml validator w3c css validator