Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LSO1
Systematic Name YJR005C-A
Strain S288c
Description Putative protein of unknown function, originally identified as a syntenic homolog of an Ashbya gossypii gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LSO1 YJR005C-A
TGAAATGTCCCGGCTTCAGCTTCCATACCCAGTATACCTACAACAACACCCGTGATGAAG
GGTGTAGACCGAATAAAATCTCCCACTAGAAGCACTCTCCCACTTTCATCTTCGAGCATA
ATTTCATCAGAACCACCCTCTTTATCAGTATAACTTTTAGTTAAATCTGGTGCACCATAT
GTATCATTGATCACTTCGTCCAGTACGTTTGGTTTATATTTCATCTCGCAATATATGGAT
CCTACGCACCAACATGGTTGGTTTCCCTGAATATCTAACACTTTGTCCTTTTTTAGAACT
AATTGGCCATTCAAGGTAAAGCCCGCATCCCATCTCTTGTCACATTCTTTTAAGACGCGT
TCTCTGAAAGTCTTTAGACGGTATTGATAAATGTGGTAGTACTGAGAACCGTAGTCACGT
TTTTTATAGCATAGTTGGAATGGATTCGATTTGTTGTAAAGATTGTCGTCAACAATTCTT
ACTCTCGTTCGTGGTTGGGACAAGTTTTCATCTTGGAGACTTCTATCCTCGTTGAACTTT
GTTAACAATGCGTCCATTGCCCTTCACTTCCATTTTTGCAGGAAAGATTCAGCTATAGTT
CGCTTATTGCAATGGGATTTCAAAAATAGTTTATATTTTAACTTTTGAAATTAATCAGAC
GCGTCTGATTAATCGTATAACATGATATAAATCTAGAGTTAGTATTGGCGGCTATTTTGC
TTTTCCTCTGGTTTTCCTTTCCCTTTGACACCCTTTTTGCCACTTAACTACTGTATAAGA
GTGGGTAAAGCACACCCACAAAGCATTGAACGACAGATTGATATCAACAGGCTGAAATAG
AACAATCGAGAATGTTGCACCCTTTTTTCCAATCTAAGCACTTGCGTACATATATATATA
TATATAGGATAATGTGTAGTCGTATTATTAACCGCCTTTTGGAAGTTTGCTAACCGCATA
GTTGTCATTAGAAACCACCAAACATAGTGAAGAAGCGAAC
Chr coordinates Chr X from 448758-448477
w3c xhtml validator w3c css validator