Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TDH2
Systematic Name YJR009C
Alias GAPDH, GLD2
Strain S288c
Description Glyceraldehyde-3-phosphate dehydrogenase, isozyme 2, involved in glycolysis and gluconeogenesis; tetramer that catalyzes the reaction of glyceraldehyde-3-phosphate to 1,3 bis-phosphoglycerate; detected in the cytoplasm and cell wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TDH2 YJR009C
CTAGATCAGAGGGTGGTAAATGAAGTGTAATAGTATTCATTTTTCTTATAAATCATCCCT
TCCGTGATTTATACAAAAGAAGAGGAGAATATGCTGAATACTTGGTATATTACTCTACAT
TATACTCTTATCTTGACGGGTATTCTGAGCATCTTACTCAGTTTCAAGATCTTTTAATGT
CCAAAAACATTTGAGCCGATCTAAATACTTCTGTGTTTTCATTAATTTATAAATTGTACT
CTTTTAAGACATGGAAAGTACCAACATCGGTTGAAACAGTTTTTCATTTACTTATGGTTT
ATTGGTTTTTCCAGTGAATGATTATTTGTCGTTACCCTTTCGTAAAAGTTCAAACACGTT
TTTAAGTATTGTTTAGTTGCTCTTTCGACATATATGATTATCCCTGCGCGGCTAAAGTTA
AGGATGCAAAAAACATAAGACAACTGAAGTTAATTTACGTCAATTAAGTTTTCCAGGGTA
ATGATGTTTTGGGCTTCCACTAATTCAATAAGTATGTCATGAAATACGTTGTGAAGAGCA
TCCAGAAATAATGAAAAGAAACAACGAAACTGGGTCGGCCTGTTGTTTCTTTTCTTTACC
ACGTGATCTGCGGCATTTACAGGAAGTCGCGCGTTTTGCGCAGTTGTTGCAACGCAGCTA
CGGCTAACAAAGCCTAGTGGAACTCGACTGATGTGTTAGGGCCTAAAACTGGTGGTGACA
GCTGAAGTGAACTATTCAATCCAATCATGTCATGGCTGTCACAAAGACCTTGCGGACCGC
ACGTACGAACACATACGTATGCTAATATGTGTTTTGATAGTACCCAGTGATCGCAGACCT
GCAATTTTTTTGTAGGTTTGGAAGAATATATAAAGGTTGCACTCATTCAAGATAGTTTTT
TTCTTGTGTGTCTATTCATTTTATTATTGTTTGTTTAAATGTTAAAAAAACCAAGAACTT
AGTTTCAAATTAAATTCATCACACAAACAAACAAAACAAA
Chr coordinates Chr X from 454681-453683
w3c xhtml validator w3c css validator