Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPI14
Systematic Name YJR013W
Alias PMH1
Strain S288c
Description Glycosylphosphatidylinositol-alpha 1,4 mannosyltransferase I, involved in GPI anchor biosynthesis, requires Pbn1p for function; homolog of mammalian PIG-M
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>GPI14 YJR013W
ATGACTGGCGAAGAATGGGGCTTGACTGTACTGTCATTCTTGGTAAGAGTCGGATTTTTT
CTTTTTGGCATTTACCAGGACGCTAATTTCAAAGTGAGGTACACTGATATCGACTATTTT
GTGTTTCATGATGCTGCTAAATATGTATACGAAGGCAAATCACCTTATGCAAGGGATACA
TATCGTTACACACCGCTACTAAGTTGGCTGCTAGTGCCTAATCATTATTTTGGATGGTTT
CATTTGGGGAAGGTCATATTTGTTATTTTCGATTTGGTTACTGGGCTCATTATAATGAAG
CTTTTGAACCAGGCCATCTCCAGAAAAAGAGCTTTAATATTGGAAAGCATTTGGCTATTG
AATCCGATGGTTATCACCATCAGTACAAGGGGAAACGCTGAAAGCGTGCTTTGCTGTTTG
ATCATGTTCACGCTTTTTTTTCTACAAAAGAGTAGATACACCCTAGCTGGAATCTTATAT
GGTCTTTCTATCCATTTCAAAATATATCCAATCATATATTGTATCCCAATAGCAATTTTT
ATATACTACAATAAAAGAAACCAGGGTCCACGAACACAACTTACATCGCTACTCAATATC
GGTTTGAGTACTCTAACAACTTTGCTTGGATGTGGTTGGGCAATGTACAAGATATACGGA
TACGAGTTTCTGGATCAGGCATACTTGTACCACTTATACAGAACGGATCACAGACACAAT
TTTTCAGTGTGGAACATGCTATTGTATTTAGATTCTGCAAATAAGGAAAATGGTGAGTCC
AATCTCTCAAGGTACGCATTTGTGCCTCAATTGCTGCTTGTTTTAGTAACTGGATGTCTT
GAATGGTGGAATCCCACATTCGATAACCTATTGAGGGTTTTATTTGTGCAGACGTTCGCA
TTTGTGACATATAATAAAGTGTGCACATCGCAATATTTTGTTTGGTACCTGATCTTTCTA
CCATTTTACCTCTCAAGAACGCACATTGGTTGGAAGAAGGGGCTTTTAATGGCCACGCTT
TGGGTAGGAACGCAGGGAATTTGGTTAAGCCAAGGTTACTATTTGGAATTCGAAGGCAAG
AATGTATTCTATCCTGGACTATTTATTGCAAGCGTGTTATTTTTCGTCACCAATGTGTGG
CTACTGGGTCAATTTATTACTGATATTAAGATACCGACGCAACCCACAGTTTCCAACAAA
AAGAACAACTGA
Promoter Sequence
Download FASTA
>GPI14 YJR013W
TAAAGACGAAACTGTACTTTCATTAGATTCTCGTGTTTCACTCATACGCCTTTATATGCT
ATCACAGTTACCTTATTTGTCCTTTTTCTTGTAGAGCTATTCTCTATTCTGCTTTGACTT
AACTAGCGTGAAATTAAAACCAACGCCGCTTATCTAATCACAATAAAAGATCAGACTGTG
AAATTAATAAAAAGGAAAGGATAAAACGACAGATATCGCACTAACTTTGTTAGAAACATT
ATGCAGACAAAAGAAGGAGATGCATGTGCCTTTGTATTCTTTTAAACGCAAAAAGGGCAG
GTCTATGATTAAGTATGAATGAGCGATATAAAATTTAAGTAGAAAAGGGAAGATAATAGT
ACTATATATAAATATATAAATGCATTTTTTTACATACCTGTTGGGTGAATAATTTACCTA
GCTGTTGGATTTGCTGTTACTGTATTATTGTCGTCATCATTGCCATCGCCTTTATTGTTA
TCATTGTTATTGTCATCATTATCGTTGTCACTGTCATTAATCTGTAACTTAGACTGTATA
TCGTAACATTCAGACAGCCTTGTTAATGAGGTCATGCCTTCTAGGCTTTCTTGATCAATG
TCCAGAGATATATTGGGTTTGTCTAATGATCCTTGATGAGATTGATGCTGCAGCTGACCT
TCCCAAGGCCTAGGTCTTGGCCTCAATGAAGGAGTACTAGCTAAACCCTCATCCAGCGTA
ACATTGGGCACCTCCACAATATTAGGTATAGGCTTGTTATTCAGAATGTGATCCAGCAAC
TCTTCATAACTAAGTTCACCACCTGCTGCCATGCTTGACTCGTTATGTTCGCAATCAATT
TTCAAGAGGTAAACCGAAACATGTGGAGCTCTTTTACAGGCTCCGATAATAATAAAAGAA
ACTTTAATAGTTGGTAAGAACTTGACAAAAAAAAACACAATATATATACATAAAAAAGTC
AACAACTGACAAGCAAGGTAAAAGGTGATAAAGTTGAAAG
Chr coordinates Chr X from 460382-461593
w3c xhtml validator w3c css validator