Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ILV3
Systematic Name YJR016C
Strain S288c
Description Dihydroxyacid dehydratase; putative 2Fe-2S protein; catalyzes third step in the common pathway leading to biosynthesis of branched-chain amino acids
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ILV3 YJR016C
ACACATACATATATATTCTTATATTATATAATAATATCCTATTTATTATTACATCACCTT
TCACGAGCGGGTATCATACCTTTTTCCCTTCGATCTAAGTAGAAAAAGGACCTGAATGAT
CATTGTGGTACTTATTCCCACGCATAACCGACTACGGCACCACAACGACGCACCAATGCC
ATCTGACGTAGCATCGAGGACCGGGCTGCCAACCCCGTGGACCGTCAGGTATAGTAAGTC
CAAGAAAAGAGAGTATTTTTTCAATCCAGAGACGAAGCACTCGCAATGGGAGGAGCCTGA
GGGCACCAACAAGGACCAGCTACACAAGCACTTAAGAGACCATCCAGTGCGTGTAAGATG
CCTGCACATTCTCATCAAGCACAAGGATTCAAGAAGACCCGCATCGCATAGATCCGAGAA
CATTACGATATCCAAGCAAGACGCTACGGACGAACTGAAAACCTTAATCACGAGGTTGGA
TGACGACTCTAAGACGAACTCCTTCGAGGCCCTGGCTAAAGAGAGATCAGATTGCTCTTC
ATACAAGCGAGGCGGCGACCTCGGCTGGTTCGGGAGAGGCGAGATGCAGCCTAGCTTTGA
AGACGCTGCCTTCCAGCTCAAGGTCGGCGAGGTAAGCGATATCGTTGAATCAGGAAGCGG
TGTTCATGTGATCAAGCGGGTAGGTTAGGTTGGCATTTGCTTCTCCACCTCACCTTTTTA
TGTTCTTATTCCCTCTTGTATCCATTCCGTCCTCGCTGAACCCATGAAAAGAAAAAAAAT
TAACTAGTCACATAGTTAAATGGCGCTGTTCTTCGCTGCGAGCGGAACCGGGCCTGAAAA
AAAATTTTCTCTTTTCCTCTCCAGATGACTCAGTAATATAGTAGTATATTATATAATGTA
ACAAAAGAAGAGACTGAAGTTTTATTATGCATTGTAGCGCCTGTAATCTTTAGTAACGGA
TTCTTGTATTTTTTTGTAAACAGCCAAGAAAAAAGTAGAG
Chr coordinates Chr X from 466208-464451
w3c xhtml validator w3c css validator