Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RBH2
Systematic Name YJR030C
Alias RBH2
Strain S288c
Description Putative protein of unknown function; expression repressed in carbon limited vs carbon replete chemostat cultures; YJR030C is a non-essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RBH2 YJR030C
GGAACTTTATGAACATATTAAGTCTGCTTGATGAAATGTCATGTGCAGGTGCCGTTGGCA
CAAAATGGGAACAAAATTATGAAAATTCAGTCGAGGATGGGTGTGAAGCACCTGAATCCA
ATCCATACCGTTCTATTATTGATCTTTCTAGTCGTTCCATTAATATAACTGCAGACCTAC
TTTCGACTGTTGGGAGGAGTAATTCAGCACTCAACAAGAATGAGATTATAGCTGCTATTC
AAGGTCTCGCCCATCAATGCCTCAATCCCTGTGACGAACTAGGTATGCAAGCATTGCAAG
CATTAGAGAACATTCTGTTATCTCGAGCAAGTCAACTACGTACGGAAAAAGTTGCGGTGG
ATAACCTACTAGAGACAGGATTATTACCGATTTTTGAGTTGGATGAAATCCAAGATGTCA
AGATGAAACGAATTACTAGCATTTTATCCGTTCTTTCTAAAATCTTCTTGGGTCAACTTG
TGGAAGGCGTAACAAGTAACGAAACTTTTTTGAGAGTGCTTAACGTATTTAACAAGTATG
TAGATGATCCTACGGTGGAAAGGCAGTTGCAAGAGTTGATTATTTCTAAGAGGGAAATCG
AGAAGGAGTAGACCAACGATAATGTAACTATACCAAGAAACTTAGTATGATGGAATTTTT
TCAAGGAGTCGTAAATTAGATTTTCGCAGGTAATAATGCGATATATAAGCAATCTCATTT
AAATATCGACGGTGGCATTTATACCATCATTTACTGTTATATTTATCTAACGCGTCGCGA
CGCGTTAGATAAAATACAACAAGATTTTTTTTTCGTGTCACCAATGGCATGAAAGCTTCG
AGAATAATTTGAAGGAAATTTCACTTAATGGGAAAAATAAAAATGTACCCTTATCGAGAT
TACTCTTTTACCCTCAGTTCAATTAAAATTCATCATGAACCAAGTAAAAGTTCCTCTAAT
TACGAACGAGCAAGCAAATTAGTATTGTGTGGGAGACGGG
Chr coordinates Chr X from 486196-483959
w3c xhtml validator w3c css validator