Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TAH11
Systematic Name YJR046W
Alias CDT1, SID2
Strain S288c
Description DNA replication licensing factor, required for pre-replication complex assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAH11 YJR046W
TGCGTCTTTAGTAGCTTGTCTTTGAGAGTCGTTGAAATAAGCTGGGACAGTGACAACAGC
ATTCTTAACTGGCTTACCCAAGTAGGCCTCAGCTGTTTCCTTCATCTTGTTCAAGACGAA
CCCACCGATTTGGGCTGGTGAGTAAGTTTGACCTCTGGCCTCAACCCAAGCATCCCCGTT
GGAGTGCTTGACGATCTTGTATGGAACTTGCTTGATATCTCTTTGCACTTCAGCGTCTTC
GAAACGACGACCAATCAAACGCTTGGTAGCAAATAGGGTGTTTTCTGGGTTCACTACGGC
TTGACGCTTGGCTGGAATACCAACCAAACGTTCTCCCTCTTTAGTGAAAGCTACTACAGA
AGGAGTAGTTCTGGAACCTTCGGCGTTTTCAATAATTTTTGGAACTTTACCTTCCATAAT
GGCAACCGCAGAGTTGGTGGTACCCAAATCGATACCGATGACGGAACCTTGAACCTTGGT
TGACTGCAAACGTGTGGCAATACGGAAAGAGCTAGACAAGCTTGACCTGTTTAGTATGTT
TTTAGCAGCAAGCATCTTGGTGCGTATAATATGAGATTTGTGTAGTCTTAATTATATTAA
ATGGGTCGTAAATACAAAAGTTGTCACTCTGGCAAAGGTTGGTGAGCAGCGGGGCGTCGA
TATGTACAGCAGGCAGAGGAGGACAGCAACGTATGGAGTTTTCAAACGTGGAACAAAGAA
CCCAAAAGTTCCCAAGCGTCGAGCCGGCGTTGGATCGTTCGTTTTTATACACCGCACCGT
AAGCGGTCACCGGAAAAAGAGGCAGGGGGCGGTGGAACCGGGCCGAAGCCCATGGAAAAG
CTCTGCCGTTGTGGGTGATATACAATTATTCAGCGCATCTAAGGCACTAGCTTTAGCACA
TTGTACCATTGCGATGATGCGGAAGAGTTTAATATAAGCAGATGTTAGTTGCGGTAGTTG
GTATCATGACAGTGAGCTGAACTACGTAGCGTCGTGATTT
Chr coordinates Chr X from 522048-523862
w3c xhtml validator w3c css validator