Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HAM1
Systematic Name YJR069C
Strain S288c
Description Conserved protein with deoxyribonucleoside triphosphate pyrophosphohydrolase activity, mediates exclusion of noncanonical purines from deoxyribonucleoside triphosphate pools; mutant is sensitive to the base analog 6-N-hydroxylaminopurine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HAM1 YJR069C
AATCCTTCGTCAATGACAAGTCTGAGTTGTTGAAGCACGAAGTGGCCTACGTGTTGGGTC
AAACCAAGAACTTGGACGCTGCTCCAACTTTAAGACACGTTATGTTAGATCAAAATCAAG
AACCAATGGTGAGACACGAAGCCGCTGAGGCTTTGGGTGCCCTAGGTGACAAGGATTCGT
TGGATGACCTAAATAAGGCTGCTAAGGAGGATCCACACGTTGCTGTGAGAGAAACCTGTG
AACTGGCCATTAACAGAATCAACTGGACCCATGGAGGTGCCAAGGATAAGGAAAACTTGC
AACAATCCCTATACTCGAGTATTGACCCAGCCCCACCTCTACCATTAGAAAAGGATGCTA
CCATCCCAGAACTACAGGCCTTATTGAATGATCCTAAGCAACCTTTGTTCCAAAGATACA
GAGCCATGTTCAGACTGAGAGATATCGGTACTGATGAAGCAATCCTGGCCTTGGCCACTG
GTTTCAGTGCAGAATCCTCCCTTTTCAAGCATGAAATCGCCTACGTCTTCGGTCAAATAG
GTAGTCCGGCTGCTGTCCCAAGTTTGATTGAAGTTTTGGGCAGAAAGGAAGAAGCTCCAA
TGGTTAGGCATGAAGCTGCTGAAGCCTTGGGTGCCATTGCTTCTCCAGAAGTTGTCGACG
TCTTGAAATCTTACCTCAACGATGAAGTCGATGTCGTCAGAGAATCTTGTATCGTTGCGC
TAGATATGTATGATTACGAAAACAGCAACGAACTAGAATATGCTCCAACTGCTAATTAGA
AGAATCAGCATCATCAATAATGATAGTAACAATAATCATTGTATAATCTTGTATTTTATA
CTTTTCAAAACCCGCCATTTCCGTTATATATACAAATGTATCAAATAGCAAAAAAATTAT
TTATTTTCGAAACCGTTCTCTCGAGCTTCAGCTTTCAACACTGGTCTTCAAAGCATAGGA
AACACTCACATAGAGATATCTAAAAACGAACGATAGCAGA
Chr coordinates Chr X from 569399-568806
w3c xhtml validator w3c css validator