Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MOG1
Systematic Name YJR074W
Strain S288c
Description Conserved nuclear protein that interacts with GTP-Gsp1p; stimulates nucleotide release from Gsp1p; involved in nuclear protein import; nucleotide release is inhibited by Yrb1p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MOG1 YJR074W
ACCAATACATATGATTGTGCTGAGACTCATTCTTGCTGTGTCGTTATTGCGTTTTGTAGT
TGTTTGTGTGCGCTAGATGCTCTCATTGTATTCCTTGTTAAATAGAGCATCGCATTAAAA
TTTTTTTTTTTCACTTTCGCGAAGAAATTGCTTATGGAGCTATATAGAAACGGTAATAGC
ATAGGCTTCTAACATTATAGAATATATAGAAATAGAGCACTTACATATTCTTTTTGGCCT
TATCACGGTTAGCGTAGATCATGGCAGTAAAAGGTTCTTCCCAACGAAGAGCGATCTTGT
ACATGAAGTAAACTACGGCAGAAACAACCAGCCCCGCAGGCTTTCCTTTGTAAAGGGCTA
TGCCCAAGAAGGACAAAGTGGAACCCTGGTACATGGGGTTGTTGGAAACGTTGAAGGGGA
AGCCGGTGACTCTCTCATCCATCAGGATGCCGAAATAGTCACCCAAGTACGTCCCTGTGA
TACCCAGCTTGTACATGGAACTCAAAACAAGCACTTGCCCCAAACCAAAGAGAGCCACAC
CCAGCTTGGTCCAGTTCTCGCCCGTGATCAGAGAACACGTAGGCTGTTCACGCAATGCAG
ACTCGTACACCATGTCTCTGACGATACCTAGCGAAAATATGGTCGCCGCCAACATGTAAC
AGCCCTTTCTGGCCCCACCACACATCTTGGTGAGAGAATGCTTGTGGTATTCCATTCTTG
CAACGATGTTCCAAAAGATAGGATTGAACATCGTGCACACAATGGCCAGCTGGAACTTGG
AAGACTGTAAATCGACACTGTGGATGAGTTGCTGGATGATCTCTTGGACTGACTCCTTCA
TCGCTTGACTTGCGCTATTCTTGTTGTCTTCAATTGCTGTTTATGGCTCTGTCCAAGAAC
GTTCATGTTCTTCATATGTGTTCTCTTATAAAGACCCCTTATCCAGTGGTCATTGCAGTG
GCAGTGGACAGAAACCAACGATGCATGTGTGGGTTTGCAT
Chr coordinates Chr X from 573095-573751
w3c xhtml validator w3c css validator