Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MOG1
Systematic Name YJR074W
Strain S288c
Description Conserved nuclear protein that interacts with GTP-Gsp1p, which is a Ran homolog of the Ras GTPase family, and stimulates nucleotide release, involved in nuclear protein import, nucleotide release is inhibited by Yrb1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MOG1 YJR074W
ACCAATACATATGATTGTGCTGAGACTCATTCTTGCTGTGTCGTTATTGCGTTTTGTAGT
TGTTTGTGTGCGCTAGATGCTCTCATTGTATTCCTTGTTAAATAGAGCATCGCATTAAAA
TTTTTTTTTTTCACTTTCGCGAAGAAATTGCTTATGGAGCTATATAGAAACGGTAATAGC
ATAGGCTTCTAACATTATAGAATATATAGAAATAGAGCACTTACATATTCTTTTTGGCCT
TATCACGGTTAGCGTAGATCATGGCAGTAAAAGGTTCTTCCCAACGAAGAGCGATCTTGT
ACATGAAGTAAACTACGGCAGAAACAACCAGCCCCGCAGGCTTTCCTTTGTAAAGGGCTA
TGCCCAAGAAGGACAAAGTGGAACCCTGGTACATGGGGTTGTTGGAAACGTTGAAGGGGA
AGCCGGTGACTCTCTCATCCATCAGGATGCCGAAATAGTCACCCAAGTACGTCCCTGTGA
TACCCAGCTTGTACATGGAACTCAAAACAAGCACTTGCCCCAAACCAAAGAGAGCCACAC
CCAGCTTGGTCCAGTTCTCGCCCGTGATCAGAGAACACGTAGGCTGTTCACGCAATGCAG
ACTCGTACACCATGTCTCTGACGATACCTAGCGAAAATATGGTCGCCGCCAACATGTAAC
AGCCCTTTCTGGCCCCACCACACATCTTGGTGAGAGAATGCTTGTGGTATTCCATTCTTG
CAACGATGTTCCAAAAGATAGGATTGAACATCGTGCACACAATGGCCAGCTGGAACTTGG
AAGACTGTAAATCGACACTGTGGATGAGTTGCTGGATGATCTCTTGGACTGACTCCTTCA
TCGCTTGACTTGCGCTATTCTTGTTGTCTTCAATTGCTGTTTATGGCTCTGTCCAAGAAC
GTTCATGTTCTTCATATGTGTTCTCTTATAAAGACCCCTTATCCAGTGGTCATTGCAGTG
GCAGTGGACAGAAACCAACGATGCATGTGTGGGTTTGCAT
Chr coordinates Chr X from 573095-573751
w3c xhtml validator w3c css validator