Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name IME1
Systematic Name YJR094C
Strain S288c
Description Master regulator of meiosis that is active only during meiotic events, activates transcription of early meiotic genes through interaction with Ume6p, degraded by the 26S proteasome following phosphorylation by Ime2p
External source Open in SGD external link
Orthologs
Candida glabrata CBS138CAGL0M09042g
Zygosaccharomyces bailii IST302ZBIST_1786
Saccharomyces sp. 'boulardii' biocodexKO01_02848
Saccharomyces sp. 'boulardii' unique28AB282_02676
Kluyveromyces lactis NRRL Y-1140KLLA0_E05963g
Kluyveromyces marxianus DMKU3-1042KLMA_70107
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IME1 YJR094C
TGCACTCAAAAACCTTCTTAGTTACAGGAAAAGGTAAAGATACGATAAGAAAAGCCTTTG
AACTGCCCATCCTGCATCCTAACACAGATCTAACTCACTATTCGGGTAAGGAAGTGTCAT
GCATGTCTGCAAAGGGACTAGAAGAAAGTTACATGATTACATAAGCAAAAAATCGGAATT
ACAGACACACCATTTTTTATCCTGCGGCCCCATTTCCGTCTTCGAGGGAAAGGATCAAAG
GCGCTTAGCCCAATCTTGATGATTCACCGGGGAAGAAAGGAATTACAGAACCCCCAGCCA
CGTAACACAGCCAATTAGTTTTCTATATCGGGAAACGTGATTGATTGCGCAATTTTGGCT
GCATCAGAATACATCGATGAGATCTAGAGCACCCTTTGATGGTTTAAGTCCGGTTTAAAG
TTAGTAGATCAATGATTTCGTAGTGCATTTTAAAGGGAGCGCTTATCCATGGGTGATTGC
GTTTACAACGTTTTGTGTGTACTCATAATAGCCAATCTAAAATTAAACAACAACAACAAC
GCACAATTAATATGTATCAGCCCCAATACCTTTTTCTCTTACTGTAATTTACTACTAAAT
TGGGGTCGGACGTTTTTGATCTTGTTCCTTGCCTGTTGTTTACCTTGTATATTACTTTTC
CTCTTTTATGTATTTAAGGTAAATTAATTATCTTTTGATCTTAATATTTTTCTCAAAATG
CTTCCCTTGTAGTTCGGTATTTTTGCTTCTTCAGATATTTAAACTACCGTATACCATAAC
TGTTTCGTGAAGTAGATACAAACATCGACTATCCTATTACGATTTATTTTACATTATCAT
ATTATAAATCGACCAGTAGTATTGTTAAAGATTAAAAGCATAATATACTACTGTCATTAG
TCACCTACAGAGAAACAAATTCCTACTGGCACCCATTACTGGTGAAAAAGGAAAAAAATA
ATAAAAGAAAAGCTTTTCTATTCCTCTCCCCACAAACAAA
Chr coordinates Chr X from 605651-604569
w3c xhtml validator w3c css validator