Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJR098C
Systematic Name YJR098C
Strain S288c
Description Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>YJR098C YJR098C
ATGATGGCAACTCCGGCTACTGATCTTATTTCCGATAATGATAAATATAACAAGCAATGT
CTTTCTGATTCAAGTGATAGTGGTAGTGATGTAAGCTTTTTTTCCGTAAATGAAAGCGAA
GGTGAATTGGATACAATGGAGAAAGTGGATACCTTGATTGGAGGTGCAAGAGTTATAAGC
AATAAAGTAGAAAAAGACAGCGATAGTGAACAAAGGGGAAGAAAGAAGGAAACAACTGGG
CCCAATAACTATCATAATTTAGAAGAGAAGCAAGCGAGTGCCATTTCTCTTGACGCTGAT
GATGAAGATCTCGATGAAATTATTTCTTATTCGCATGACGGGAACTATGACAGCTCTCAT
AAAACTTTCTCCTTTTCCTTACCATTTGGTAATACAAATTTCCGATCAAGTTCACCATTA
GCCATAATTAAAACTGTGCTTCCCAAGACTCCAGATGAGTTCATCAAAAAGAATCTAAGA
AAGAATGAGATCAAGCAAAAACTGAAAAAATCAACCTCCATTTCTTCCTTGGAAGAGATA
GAATTATTTAAATACGAAAGGGGCATTGATAATTCAAGGTTAAGGGCTGTTAAAGAATCT
TTGGAAATGGATGCCTTGAAGAACTCCATTAAGCAAATAACAGCAGACCCATTCGACAAA
ACTCATGACGGATATTACCGTTCGCGTTTAGAATCTATATGGAATGAATTGGAAGGAGAT
GTCGTTATAATGGGTGGATATCGAGGTAGTGTGCTAAGGGATGCTACTACTCATAAGCGA
ATTTGGATCCCATTAAAGGCAGGTTTGAATATGACGAAAGTCGATTTATTGATCGGACCT
AATGACGAAGATGAACTTAAAACTCAGAAGGAGATTGTCCCTGATGGAATGCTAACACAT
ATAGGGCCTGTTGATATCTCTAAGAGGTTGATAAAGAGGCTAGACGCAAATCCTAATTTA
AATGTTCAGCAGTTTGGCTATGATTGGAGATTATCCTTGGACATATCTGCCAAGCATTTA
ACGACTAAACTAGAGGAAATTTACAATAAGCAAAAAAATAAGAAGGGAATATACATCATT
GCCCATTCAATGGGCGGATTGGTCGCACATAAAGTGTTGCAAGACTGTACTCATTTGATA
AGAGGTATTATTTACGTGGGTTCCCCAAGCCAATGTCCAAATATTTTAGGTCCTATTAGG
TTTGGAGATGATGTGATGTGGAATAAAACTATTTTCACTAAAGAAACCAACTTTTTTATG
AGAAGTAGTTTCTATTTTCTACCGTTAGATGGTAGATGTTTTGTTGACAAAATTACCTTA
GAGAGGTATGATTTCGATTTTTTTGATACAGATGTTTGGAAAACCCTTGGCTTGTCACCT
CTCGTCAATGAGAAAAGAGAGGAATCAGCTCACGAAAAATCAAAATTATTACCAAGGAAA
ACGAAATCAGCGCTTTCGCTTAAAGCTACCCTAAACGCAACTACCAAGTTTGTCCTAAAT
GCACCTGTTGTTAGGAATGTAGCCGGCAATAATAAACAGGTACCAAGGGATGTGCCTTTC
GATGAAGTCTTCCATACATCTTATGAAGATAGCTGTGAATATTTAGCGAGAACTTTAAAA
CGTACAAAGAATTATTTGGATAGCTTAGATTACGACCCGAACAAAGAATATCCTCCATTG
GCCATGGTTTACGGTAACAAGGTTCCCACTGTTAGAGGTGCTAAAGTGAACGGTATACAA
GATATAAAAGATGGGAATTATGAAGATTTTTACTATGGTCCGGGCGACGGTGTTGTTCAC
CATAAATGGTTATTGCCTGAACAGAGAGGCTTTCCAGTTGTTTGTAAAATCGCCAGTTCT
TCAGGTCATGTTAGCTTAATGACGGATTTGAAATCAATGGCAAAAGCATTCATATCTATC
GTCGACAGCGAAAAAGAAGGAAGAAGATCTCGAACACGAACTTCTTCATGA
Promoter Sequence
Download FASTA
>YJR098C YJR098C
CTCTTTCCCAAATAGAGGGGTCCGCTCAAATTCCTTCCATCCAGTTCAAATATCCCTCCG
TTCTCTTCCACATATGTGATATAGTGTAGATTAGTATCTGCAGTTGCTTCTGGTGCTTCT
GACTGGCCAGTAGAAAATGTTTGTACATTCTCTTTTATTACATTCAAGACGAATTGGTCG
GTAGTAACATCATCAAACCTATTCTTCGAGCTTGAAGTATCACTTTGAGATTTTAAAAAA
TTGTCCAAGTCGGAGCCGGGCTCCAACAATGACTGGTTATTGCTCAAAGAATGAAGAATT
GCATACAATCCGCACGCATTTTTGACTGATTGCTTAAACCATATAACATCATAAGAACTT
GTAATTTGTTGACTGGTACTCGATTTTCTATCCTCGTTTATCGGAAATAGCAGCACAATG
GCCTTCACTGGCCTTGGTAAGAATGCTAGTAACTCTGGCTCTGTTAAGCTATAGATATCG
AAATACGCCCATTCATTTTTTAAACCTAATTTATGTGCAAAATTTGTAAAAACTTCAGGG
TTTGATTCAATCGGCACCACAGCACGATTTTCTCCGCTCATACTTTTGCTATTGTATTTT
TATAACGATTGTTACTTACTTGTTGATCAAAATACCCTTAATATCTCTTAAGTATGGACT
TCCACCTTTATAGTCGACTAAATAAAAATACTTCTACTGAGGAAGTTTAAAACACGGAAA
AATTGTTCCAGATCATTATCTGCACTGGTTTTTGGGGCGTTGATAGGCATGTTCACACTT
CCTAACTCGACCACAGACATCTCCAAGAATACAAGGTACTTCAATCCGGGTAATAAAACG
TCAGGAAGTTTTGAGAAGTTAATAGCTCATCACTGCATTCTCAAAAAATGCTTACAACTC
TATGACGCCCTTAAAAAGAAAGGACTGGGTAAGAATAGCCTGCCTATTTTGGTGATACGT
AAAAGAATCAACTTGTAGAGGTTAACTGGGGAGTATTACA
Chr coordinates Chr X from 615156-613186
w3c xhtml validator w3c css validator