Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ABM1
Systematic Name YJR108W
Strain S288c
Description Protein of unknown function, required for normal microtubule organization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ABM1 YJR108W
AAGGAATATCGTAAGCTTATAGAGGAAGGAAAAATCAGAGAATGTGAAGGTTGTAAAATG
CATAGAGGATTTCTAAGGTTCACAGAAACTCTCGGGATGGACGTCTTTAAAAAAATGGAG
TCGATTCTGGAAAGCTTTCCGGAATATAGGATCGTTGTCACTGGGCACTCCTTGGGGGCA
GCATTAGCAAGTTTGGCTGGGATTGAATTAAAGATAAGAGGCTTTGATCCGTTAGTGCTG
ACATTCGCAACACCAAAGATATTTAACAGTGAAATGAAACAATGGGTAGACGAGTTATTT
GAAACAGATGCTATAGAAAAGGAGTCAATTCTTAAAGATGAAATTCAATTTCGTAAGGGC
TATTTTAGGGTTGTGCATACAGGTGATTATATTCCTATGGTTCCACCATTCTATCATCCG
GCTGGTTTAGAGATGTTTATTAACAAAGTTGGTCTACCTCAGAATGCGGAAGATATTGAA
TACCGTGGTAAAAATAACAGGTTAACTTTAAAGGATGGATTTCGAGAGGGTATGAGCGGT
TTGGTTGAAGACTGGTTACATGTCTATGAACATCGAGCCTACTTCATTGACGTAGTGGGA
TGTTCTGGACTTTAACATTCACCCACTTTTACGTTTTTGTCTATAACTAGCATATATAAT
ACCGCTCTAGAGTTACTCTAAACTAAATGCGACCACTATTCTTAACTAATAATTGTTCTT
TTTACAAATAACTCTTTCAAAACTTCTAATCTTTTCTCTTACGTTTTCCATTTATCTGCT
CTTCTTCTGAAACTCTTTTTCCTGCATTGGCCCTCTCTTTGTTACATGAAAGAGGTTTTA
GGGTTGGTAATATTTCTGGTTGTAAACTTCTTGAATACACTTGGGTAGCTAACTGCTTAT
TCCAGTTCTCCTGGCCACTAATCCCGGCTACGCTTTTGTTGAAATAGTATTCTTCTACAG
CATCATAGCTATCATCACACATGTCTACTAGTTTCCACGT
Chr coordinates Chr X from 628712-629083
w3c xhtml validator w3c css validator