Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPA2
Systematic Name YJR109C
Strain S288c
Description Large subunit of carbamoyl phosphate synthetase, which catalyzes a step in the synthesis of citrulline, an arginine precursor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CPA2 YJR109C
GAAATCCAATGAGAATACCGCATAATCTTTCCCAATTACCTTGATATTTACAAAAGACCA
TAGATCCTTACCCTGGTAAAGCTTGTAATTCTGTGAATCCGTTCCCTCCAATTGGATTTG
ATTAGTGGAAGTCAACTTGGACAGTAATGTACTACCCGGGTTTTTATGCACTCCATAGAT
CAAAGGATATGGAAACCAAAATTCCGTCGACAATTGTGGTGACTCAAAGATCAAATGGTG
AGTAGTCAAATGTAAAGTACCTTGTGTGGCCGTACCTCTTCTATGCAGCACTACATTAGA
TACTTTGGCAATCTTGATGTACTCCATCTTTGCGGAATGGTATACTATTTCTTTTCCCTC
TTTTTAGCACTATTACACCCCGCCCACAAAATAAAAATAATAACGACGACCTAATCTCAC
CAAGTGACCCTTGTAAAACCTCCTTTTCTTTATAATGTTTCTTTTCTTACTAATATTTGG
TACATTTAGGGTAGTGATAAAAGAATGGCAACATTGTTATTATTGTGAAAAATGAGGAAA
ATAGAAAATCAGAAACCCTAAAAAGTGATTTTACCCTATCAGAAATATTCAAATGTCCTA
ATTAAAAATAGTAAATCCCCTAAACATTCAGATTGTAAACTAGGGTTGAGAAAATGACTC
ATCCACCACTGTCTTCTTTCCTGCGGCATTCTATAGATTATTGTGAATGACTCTTATTGA
TGAGATGGCAATAACTTTTGAATATCAGAGATAGGAACCTCCATGTCGTAACGATTGTGT
CACCTTGAGTAAGCATCGAGAAAATCCAATCTTTTTTTTTCCGTCATAAGCATTTCTGCC
ATGCTATTTGTATATATATAATTACTAATACGTCTTCTATAGTATGCCTTATCTCTTTTT
TGAAGCGCTATTTAAGTTTAAGCATCGAAAAACTAACATCTATAGTTAAAATTAGTTCTA
TAAAGGAAGAGCAATACAGTACATAGACAGGAAGAAAAGA
Chr coordinates Chr X from 632941-629585
w3c xhtml validator w3c css validator