Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJR115W
Systematic Name YJR115W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJR115W YJR115W
TGACTAACATATACCTCCTCGCACAATGCAGCATTATATTCACCTCAGATCCGTATCTAT
CTATTTTTCTTCTGAAAACGATAGCTGCTGTCTTTTCTGTACGTGTATAATGTGCATTGT
ATGTAGTAAGCTATTTCTCAAGCAAATGTAGATTGGAGCCAAGACGAACATTTAAAGCCG
TATAGAACTACTTTGTTTCTTCTTCAGATGATCATTTCTCATATATGGTCACGTGGCTCG
ATGTTTATCGCTTTATCTTTTTTTTTTTTTTTTTTTTTGCTTTTCATTTTGGCTCTGCTC
TCTGTATTAGCTCATCATTTAACGCAAATGACCACGAGACAATAAACCGACGAGGAATGT
GCTCATATGTCTCGCCAATACCTCTAAATAATTGACCGCGCGATTATTTAGTGTGACCAG
AGCAAAGTAGCTTTGCGTCCGACCATGCAACCATGGATATACTCAAAAATGGCAATAGTG
TGCCCCTAATACGTTTGCTGGCCAGTATCCCTTTCTGAAATAAGCTAAACCCTTGCAACC
ACCAGGGGTGCCGCCGTCCTAACTTTCCAGCCTGGCAGCGCGTCGAGTCGCCGAATGTTG
CGGGCGCTGCCCCGCCCGCAACACCGCGCCCGCCCTGCCTCAGCTTAACCGAAACCACAC
GGGTCTGCCATCTTCCATATACCCTGGCTCTTCTTTCACAATGCCCGCTCACAACGCCAA
CTGCAAAAGAAGCCCGCCCTTAGTCGGTTTTCCCCACTTTGATATAACCCCCCCCCCCCC
CCCCCCGCATCAACTGGTAATTTAACCCAAACACCACGGGGTCATAATTTAAAAGCGAAA
AACCTTAAAGCGTTCTCGAAGAAATCTTCCTGTAGATGATGTCGTAGCAAACTTATCTTT
TAGAGTGTTTGTGCTTACTGCATTGTCAGATCAAAATTTACGTAGCCGCCCTTTTCAACC
CCTGTCGAAGAGTAGCATAACAGCAGCGTAGTGAACGTGC
Chr coordinates Chr X from 639942-640451
w3c xhtml validator w3c css validator