Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJR120W
Systematic Name YJR120W
Strain S288c
Description Protein of unknown function; essential for growth under anaerobic conditions; mutation causes decreased expression of ATP2, impaired respiration, defective sterol uptake, and altered levels/localization of ABC transporters Aus1p and Pdr11p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJR120W YJR120W
TAAAAGTACACTTTTTTTTTTAGTATTTCCGATGCATGAGTAGAATCTGAATATTCTACA
ATCGTATAAGGTTCCCTAAGTATAAGTTTCGATGGATCCTTAACGGATCTTTTAAAATTA
TTTAACTGTTTCATAAAAAATAGCCTACACCTATTTTTCAGGTCTAGGTTCTCCAGATTT
TGAATTCTTGGTTGAAAAGTAAAATTTTCCATATCAATAGAAAGTGGCGGGCAGAACCCG
TTTGGTGGTACGACCTTGACCATACCATATCGTACACCAAGCCTTTTAATGTGGGGGTTA
GAGAGATAATCGATCGGATTTTTGAATTCTTGTTCCGTTGGATACAGGGCAGGAATTTCC
TCCATGATAGTGATACGTTTTTTGTGCAAGATGAGATTAGTTAATATGATCTAGAGGTAA
AATTGACTAAGTAGTCAGATCTTATTCTACATTGAGCCTGCGTTGTCAACATGCACATCT
CTGTCTCTTGGGATGATAATTTTTCAATGATGATTCCAGGGTTACTTTAACGTTACACAA
AAGAAATTAATTAGTGCGGCTGTTTCTGTGAGCGGGGCAGTAAGTCCGAAGCCCTTGATA
TTAGCCCATACCCTACACATTTTACTCGTTTGCCCTACATCAGATAAAATACTGGCCCTA
AGCCCTCCTAATCTCTTCTGGTTACACCTAGGGTAAAATATCTGCCTTTCTTTGCATTCA
ATGCGTTACTTCTATATCACGAGATGAGCATACGGATCGTGTATAATACTAAAAAGAAAG
CTCCTGAAAGAGTTGTGACAAGCAAGACTGTATACTACTCCTTCTACGAAAGTTAGTTCG
AGTTCTTGATGGCACTTGGCTATTCTATTTCTTGAACCTTTGAGAAAGAACAGAAGTAAA
AGGCTGTGTATTCTGCTACATGAAATACAGTAGTAGTCACAGTACAAAAATACTCTAAAC
CAGTAATAAAGCCACATATATATGTATTTCCTTTCACGTG
Chr coordinates Chr X from 647126-647476
w3c xhtml validator w3c css validator