Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJR128W
Systematic Name YJR128W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified ORF RSF2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJR128W	6322587 upstream sequence, from -1000 to -1, size 1000
GAAAAGCCGACTTGATGCGGAGCGTCTTCAACGAGCTCGAAATTGGTAATTGAATGGTGG
GGGCTATTGCTACTAGACATGTAAGTCATTGCACTGGATGCAGAGAAAGACGCATGTCTT
TTCGTCTTATGCATGGAAGAGGGAGTGTTCGCCCTGTCGATAACAGCATCGCTTGATGCA
GAGTGAACTGGCACGCCTTTCGTGCTGAACTTGAACTCTCGAAATCCTAGGGAGCCTGCC
TTACTAGGAGGAGTTTTCTCTCGCTTATCGTTCATTACTGGGGCCGAGACGGGAAGTTCT
ACATTATTTGATTTGGCCAAGGCAACCACGGCCTCTTTCAATTCTTCAGATGTCTTACCA
GCAAGGTTCTTCGGGGTGGGTAGAATAGTCTCTTTATTTCCGGCTATTTTAATGATATGA
AGGTCGGTTGGATCATCCGCCGCCACGGAATGGCGCCGCTTGGAGGCAAAAGAAGAAGTC
GAATTTGGTGCTGGCGTCATTCGCCGTGGATCCCCCGTACCTACAAGAGCAGCATGAAGT
TTTTGCTGATGCCTGAGCACTAAATCTCTACGAGCAAAACACCTACCGCAAAAGATACAA
AGATACGGTTTCTCACGGGTATGCGAATGCTGATGTCTCTTCAAATGCTCCTGCCTGACA
AAACCCCTAGTGCATGTGGGACACAAGAACGGTCTTGGCTTATCAGTCTTAATAATTCGA
GATTTTTTAGGAATGGGCAGAATACCTTGACCAGCGGGCTTAGCGAAATTAGATTGATTA
CCGTTCACAAACATACTTGGCTCCGGCACTAATAAAAAATCTTTATCTGCCCTATCTATT
CTAGTATCGCCAATGTCTTTTAGCTTCTTCGCCCTAAAGTTTCTTTTTGGTGCAAGAGTC
TTCGAGAAAAACGTGTGTTGAGAGAGGCAATGTTTAACGAAGAAAAAAAACTCTATGGAA
ATCCAAGAAGTCCTTGTTTCTTTGTTTTCGTTTCTAATAT
Chr coordinates
w3c xhtml validator w3c css validator