Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET5
Systematic Name YJR137C
Alias ECM17
Strain S288c
Description Sulfite reductase beta subunit, involved in amino acid biosynthesis, transcription repressed by methionine
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET5 YJR137C
CCAAACTAACATAAAGGTCTTACTATGTTAAAAGTTCTTGTCCTTGAATAGAAATAAATG
AATGAATCTAGTACCCTTCCCCATTCACCTAAGTTGGCTAGCCATATTTTCGGAAAAAGA
GTGGGAGGAACAAGATGCTAGATAAACAAATATTCATGTTATTAAGCTTAGAATTTTGGC
TCTGTTTTGTTTATTTCCAGATTTCTATTTTCTGCTATTCATCCAAAATATATTTTCTCA
CAAAAGCTGTTAATTTGAAACTAATGTTAAACAAAACATCTCACTTCAAATTGAAGCCAA
ATTAGAACCTAAGTAACCAACACACGCACAACTTTCATCCCTTATCCCACTTCTTTGAAA
ACTTTTAGAAGCCATTGATGGTATTGTACATTTACCTATCTTAGCAGATTCCTTATTAGC
CGCCGAAATGGGTAATAAGTATTATAATCACTAAATACGAAAAATTTATTCATACCAACC
CGCAACATGAACTACAAACCTTTGGGTATATAATGACAAAGACGTATCAAACCAACACAT
AAGGCTATTTTCAGGCAACTAATATGCTGTTTTATCTGCGGAATTTCACCAACTGACTTT
TACTAAGCACTCAATAAAGATGCAGGTAAAATACGTGGATTTATGAATCCGGGTAATATA
ATTTGTCCACGTGATATTTCACAGAATGAATTTCATCACGTGCGTATTATCTCTTAACTC
ATAATGCCACAATTACCACCACACAGAGGCAGGAATGGTTTAACTGCTAAGAGACACTGG
AAAATTTGAGTCATGGAGATGCGACGAATTACTGGCCGCTGCAAGCAGTTATATAAAGTG
TTGGAAGACGATAGTTTTTAATGTGAAATAAAATTGGGATATAGAAAGGTTCCTTTGCTT
GTTATTTTTTTTCCATCGTCTTGATATTTATTCAGATCCCTTATATACTAATAAAGTAAC
AGTAGGGAACGGGAACCAGAGAAAAACAAAAGATTGGCGA
Chr coordinates Chr X from 683285-678957
w3c xhtml validator w3c css validator