Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS4A
Systematic Name YJR145C
Alias eS4, rp5, S4A, S4e, S7A, YS6
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; mutation affects 20S pre-rRNA processing; identical to Rps4Bp and has similarity to rat S4 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS4A YJR145C
GGAGAAGTGAGCCCGTTCTGGAGATATATGTCCAAATATTTGCAGATCCAGTTTTGTCAT
TATAATGAGATGCCTTTTGGGCGACAAAGTTCGGGTAAAAGAAGGACGGGTCCAGGAAGG
CCGTGGCCACAGAACAATGCGCAGAGAAGATTTCCGGTTTCTTTTTGGCTTTTCCGACTT
TCATCTTTTAGAACTAAAGATTTCCTGCATCGGTAAACCTTAGCAATGTTTCTCTAGAGG
GTTTTTGCACACCAGACACGTCGCACGTGCTCTTGCAGAGACTGCTGCGCTTTCGTTTAC
ACTCAGATAACATAGTCTAGCTAGCTTGCTGTCGTTCGGCACGAGATCTAATCCTTCTCC
TGGCCTACCGTCTGTGCAACCATTAGTCATGATTACGTGTGTTGCGCCTTATCTTGTCAT
TATGGCAGCATACTTTTCGTAGTCCTTTCCTGCGCAGCTTGTCCATTTTCGTCATTACGT
AAAAAGTCCTAATGGAGAGCTGGGTACTGCATTTTTTCGATGTTTTCAATATTCAGTTCA
GCAGGAAATAAACAAATAAACAAACATTAAAATATCCTGGTTTTTTTTCCCAGAGACGCG
TGGAAGCACCCATGCATCCACTATTTATTTTTAAACAGCCGTACATTCTGTAATTTTGCT
TCCTTTTTCTTCCTGCGTTCTTTTTTTCTTGAACTGTCGTTTTCCGTTATTTTTTTCGGT
GACATCAGTTGAAAGTAGCAGCGGCCTAGGCCGGGAGGCCGTGTAGCTCTTTGTAGTCGT
GGTAAGGGGGAGTAGCAATTCACTTAGTACGTGGTCTTGGAGTTAGGCTGGCTCGGACTG
GCCCTGGCAAGTCCTGTTCTGTGTGGTAGTATTGAAATTTCAGAGATTGTCGGCAATACT
AGTATATTAAAAATTATACTATAATTTAATCTAGTGTTGAAATACTTTCTTATATAGCGA
TTTTTCTGCCCAAAACAAACCAAAGAATCAATACGCAAAG
Chr coordinates Chr X from 702798-702027,703068-703055
w3c xhtml validator w3c css validator