Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BAT2
Systematic Name YJR148W
Alias ECA40, TWT2
Strain S288c
Description Cytosolic branched-chain amino acid (BCAA) aminotransferase, preferentially involved in BCAA catabolism; homolog of murine ECA39; highly expressed during stationary phase and repressed during logarithmic phase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BAT2 YJR148W
CCACCAGTTTCACGCCTACCAAACCGCTAACTTCCTTCAAGAAAATTTTGAAGCCATCAA
AAAGGTTGTATGCCCGGACTCTTGTCTACAACACCAGCAACGCCAACCAAAGCGCCCCAA
ACGCTACTCGTTGCTGTTACTAATACCAAACGCATCCGAATTGTCAGAAACACCTTTGAT
GCGCTTCGCCGGCGTGTTCGAATTTATGAACTGCTCTTTGGATACGGCCACTCAGTGGCA
CCCGCAGTTGCATCCCGAGGCATACGACCTTCTTTTCGTCACCGTGTCGCCCAACATGCA
ACAAGAACATCTCATCTACTTCAAGAGACTGAGAAACCTACTCCCAAGCTTTCCTGTAAT
AGCCATTATTAACAGACCCGTCTCCCCTCAAGATACCAGCATTGCTCCCTCCAACTACTC
TCGCTATTATTTCCACCATTTTTTGCAGTTGGGGTTCAGTGACATCCTAGTTAGCCCCTT
CACCCCAACACAACTTATAACGCTCCTTTCCAAACATCTTCGAACGTGAAAACCTGCCTC
TGAGGGTCATTCACGACCTAGCATACCACTATATACGTGTACGATTTTTTTTTTCTGTGA
CCGCACTACACCAAAGTTTAATGTTCCATTGGCCCCGGAACCATTCTTGCAAACGGCGTT
CTTTTTCCGCTTTCGGGTGACACTTAATTTAGCTTCTTTTCCCTCTCTGACACCTCTTGT
TATCTAATCTGTAGATCCGACTCTTTTTCTTTTTGGTGTCGTTCTTCTATGTCCGTTTTT
CTGTCAACAAAAACGGAAATAATAGGTAGAAATTAAGAGCCGTACGTGAGTGAGAGGAGA
TCCGAAATGAGCTGACAGTATAACTAATATAAGCTTACAAGATATTCGACTATTTCCTGG
GAAAAAATTCATTCCTTTGAGAAATCCTTAATAAAAACAGACTAACTACTAAAATTTTAG
AAATTTAAGGGAAAGCATCTCCACGAGTTTTAAGAACGAT
Chr coordinates Chr X from 705744-706874
w3c xhtml validator w3c css validator