Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAN1
Systematic Name YJR150C
Alias CCW13
Strain S288c
Description Cell wall mannoprotein; has similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>DAN1 YJR150C
ATGTCTAGAATTAGTATATTAGCTGTCGCCGCAGCATTAGTGGCAAGTGCAACCGCCGCA
TCCGTGACCACCACTCTATCCCCTTATGATGAAAGGGTCAATTTGATTGAATTGGCTGTT
TACGTTTCTGATATTGGCGCCCATTTATCTGAATATTACGCTTTCCAGGCTTTGCATAAG
ACTGAAACATACCCACCTGAAATTGCCAAGGCTGTTTTTGCCGGTGGCGATTTCACCACC
ATGTTGACTGGTATTTCAGGTGATGAAGTGACCAGAATGATCACCGGTGTGCCATGGTAC
TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGAAGGTATTGCTACTGCA
GTACCAGCTTCTACCACAGAGGCTTCTTCCACCTCCACTTCAGAAGCTTCTAGTGCCGCC
ACTGAGTCTTCTAGCTCCTCTGAAAGTTCAGCAGAGACCAGCTCAAACGCTGCTTCCACC
CAAGCTACTGTTTCATCTGAATCTAGCTCTGCTGCAAGCACCATTGCAAGTTCTGCTGAA
AGTTCTGTTGCAAGCTCTGTTGCAAGCTCTGTTGCAAGCTCTGCTAGTTTTGCCAATACC
ACAGCTCCAGTTTCTTCTACATCTTCTATCTCAGTCACTCCAGTGGTCCAAAATGGTACT
GACAGCACCGTCACAAAGACTCAAGCTTCCACTGTTGAAACTACCATAACTAGTTGTTCA
AATAACGTCTGTTCAACTGTGACTAAGCCAGTCTCCTCCAAAGCTCAATCTACAGCTACT
TCTGTCACATCGTCAGCATCTCGTGTTATTGACGTTACCACTAACGGTGCTAACAAGTTC
AATAACGGTGTTTTCGGTGCCGCTGCTATTGCTGGTGCCGCCGCTCTATTGTTATAG
Promoter Sequence
Download FASTA
>DAN1 YJR150C
ACAATCTTTGAGCATGTTTATGGATGCACTTAGGGGTCCTACAAGCCTTCGTATGAAGTT
GCCCCTCGCAAGCACACTATAAATTCATGAACAATTGCGCAGTCAAAGTTAGATTGTAAG
CCGAATTCAAACGATTTCAACAGTCGTAGCTAACGAGGCCTTTTGTCTCACACCCTTACA
AAGGGACTGTAGAATGCAAGGGCAAACAGGCCTGAGGTAACTTTAAAATATAATGTACCT
TGAAAACTATGTATACATTGCATTTATTAAGCAGTAGGGTATTTTGTTTGCAAGAAAATA
AAGCTCAAAATATCTTTGGAGTTTGACAATAGTATAGAAAAAATAGCTCAGCAACCTTAA
TAAAAAAAGGGTCATTGGGCAAAGCGTTTTAAAAAGATTTAAGTGGTAGTGTTTAAAGTG
AAAGAGATTGATATAGTTAAAAATTGTTGAGCTCAATTCACGCTGGATTCGGCGATCCGT
TTTCTTCAATCCTCACGTGCTTTCTTCGTTTGAGTGCAAAAGTTCATATGATGCTATCTC
CCGCTTATCTTATTAGTCGAAAATGGGGAGAATTTCCTATTTTATCTGTCGTTTAGCACA
TATGGCCAGGAAAATACATAAGGTTTCGCCGAACGACGGGGTCAATTCGTCCTTTTTGTA
CACATCGTTTAATTTATGAGGAAAAATTGATGAATGTATCCTCCGTAGACGCTCCTCTGA
AAAGTTTCATGTTTCCTGCGCGTTCCTTTGATAGGCAATAAAACAATACAACGCGTGCCT
TTGAAAATGCCAAGATCTATACGAGGCCTCTAACAAAACATCGTTCAGGAACAGAGAATG
CTAGAAATGCAAAAGGGTCCCTGGGTACTCATTGAATAGAAATGATTGAAAATACTGCGT
ATAAAATAGCACGACTAAATGATACTATTTTTATGTCGACACGGTACTATTTCTTCTTTT
TCAGATAAAAGTGTAGCATACTAAATATATACCCCAAGTA
Chr coordinates Chr X from 709707-708811
w3c xhtml validator w3c css validator