Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAN4
Systematic Name YJR151C
Strain S288c
Description Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAN4 YJR151C
ATGAACTATTATGATTGGCAAGGCTTTTTCTTAATTCAAGTCACACGTCGAGGTCTCCCT
TGGAATTCGTATAAATCACACTAAAAGTTCTGTGGATTCTATTAAATGAAAGCAACGGTT
CCGCTTTGGATGCATAGAACCTTCGTGAGTAATTATTTTCCAATTGGAGGAATGGATGTT
ATCATCAAACGATAACATTCATAGCCAAGAAGTATTTGGGTTTTCTTTTTGTCACATGTA
GACTTTGATACTTCTCTGTGCAAGCTATGACAGGTTACAAAGCGCATTGAGTGGCGGGCT
GCAAAAAAATGAGGAGATATTTCAATTAACAAGATCTAGTTTCCTAATACGGACCTTTTT
CGGAGCGCTAGGATCAAAATTGGATAGCACAAACAGCTTCTCTCTCTCTACGAGCTAAGA
TCCTCTGAATGGTGCTTGCACATTCTCGTTTGCAGCATATTTACTCCTTTTCGAGTGTGC
TAAACCCCAAGTGACCCAGTGTCTACTGACTGGGAAAAAGTGATCTTTCTGTTTGGTAGC
GCGTATAGCACGTAGAGTAAAGTTATGTGAATGTCTATTGAACGACGACATCAAATTAAC
TTTTTTTGCAGTTCTGTCACTTAATCACAGATAATAAGAGCAGAACAATTTAGGCACGGG
GAAATTCGATCGATCTGCCCATCCGTAGGCGTTTTCTCCGGAGAAGTTTTTACATGCTGC
GCATTTCTTTGGCGGTGAAAAAGACAGTACATCGCGTGCCTTTAAAGATGTCAAAAATTA
TACGAGATCTGTTTAAGATCTCCATCGTTCAGGAACTGTAAAACAAGAAGCATTGGCAAA
GATAGTGATTTTGCTCCAATATATTCGTTTATACAACAGCTGTTTGGTTCGAAAGCCTAT
AAATGGCCTGTGTAAATGGCTGTATTGAGAGTATGCTCAAACTGAAATAAGTACCAGTTC
CTGTCGAATCTGCGATATCCGAAAAACTCCGAAGAAAGCA
Chr coordinates Chr X from 715740-712255
w3c xhtml validator w3c css validator