Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL5
Systematic Name YJR152W
Alias UREP1
Strain S288c
Description Allantoate permease; ureidosuccinate permease; also transports dipeptides, though with lower affinity than for allantoate and ureidosuccinate; expression is constitutive but sensitive to nitrogen catabolite repression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL5 YJR152W
CCATATCTTCAGTGAGGATAACGAAAGATAAAGAGTGCTGGCTCACATTAATGGAAAAAG
AAATCTACCCGCTAATTGTGATGGCTCAGAGTTTCTTCTTATGATAAGGATGTTAGTTTA
TATCTTGACATGTGTGTTTCTATTGTACACCGTAATAGCAGATTAGATAAACGAGAGGTC
ATTCGTAAGGATGAAAAAATGAACATCTGTTTAACTTTCAAGCTTTCTACCATATAGCCG
AGATGAGCAAATACATTAAAACATCAAAAAGTGGTGCTTGAATGCTTATTTTATGACGCA
AAGCAGATGTAATGCATCCCGAGTAAAACAGAATACTTAATTTGACTTCAGCAAAATAAC
TACCCAGAATGAACACCGAATTTGACATTGATAACAAGACAATCTAGGAATACTTTTACA
TCAGCACAATATCCATGGTGGATCCCGGCGGATTTTTCTTTCTTATTGCACCTTAATCAG
GTTTACAGCCTATGACTGACTCTGGAGTGTCCTTTCCCAGTATCTGATTGTTTCCGCAAC
ATCTATGCATATCAGAGAAGCGTTCTCATCAGTCACTTGACAAATGCTCGAGGAGCTATC
ATTTGCTGATAAGGTGCTACAGCGCGCTCCTGCCGCACGCTTTGTTCCTTTTCGATAAGA
GTCCCTCGCGTTAGTCTGAGTGAAGTGCGGAATTCAGCAAACGAATAACAATCGACCTTA
TGATCATGTGGATTATCGGGGCAAAAGATTTGGCCAAGATGTCAGAGAACGTTATCACCA
ATCACTCACACAATTAAGTGGTAGTGTAACTCCGAAGATACGGCTAATACTTATCATTAT
CTGGTTTTCCGAATATACAGATTGGATGAAGTAATATATGTATATAAATGGACCAAGGAA
ACATCAAATTAGGAGATCATGAGGGAAAGGTTTAACATAACAACATTGAAGAAAACAACA
AAACAAGGATAATCAAATAGTGTAAAAAAAAAAATTCAAG
Chr coordinates Chr X from 719666-721297
w3c xhtml validator w3c css validator