Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET14
Systematic Name YKL001C
Strain S288c
Description Adenylylsulfate kinase, required for sulfate assimilation and involved in methionine metabolism
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET14 YKL001C
CTTTTGTCAATACTAGTGTTTAGGATATTTCTACTAATACCTAATACCTCAATGGTCCAA
TACTAAATAAGGTACTATTCATTGTATTGATTGATTCTGCATTTATCTTTCTCTTGAACC
GTAAATATCATTTTCATAAGTCACATGATAAAAACATATTTAAAATTTTAAAAAAATTAA
TTTTCAAAATAAATTTATTATATTTTTTTAATTACATAATCATAAAAATAAATGTTCATG
ATTTCCGAACGTATAAAATAAGAATGTTACGAGAATTTGTTTTCTTGGTAATTAAAATAA
TCAAATACACATAGAAAGGAGAGTAAACTGCTTCCTCTGTATAAATCAAAGCAAAATTGT
AAATAGCGTTGACAAGTGATTACAGAAGTTAGGTGAGGTTAATTACCAATTTCTTTTTTT
AAAATTGGTGAAATAAGATTACGTTTAAAGGAGCATTAACAGGTTTACTCATAACAATCA
TTTTCAAATTTCCCTATGCATGTTTAGAGCAAGCGCCTTTGTGAGCCCTCCCGGTTACGA
CGCCTTGGCAATGTAGCAGATAACTCTGCACTTCTAGAATCATTCCACTACGACATTTGG
CTCATCACCAGCTCGCGAGAAATGTAAATAAGCCAACAACCAAGAATGCGTAACATTAAA
GAATACAGTTGCTTTCATTTCGGCGTGATGGTACGGCACCCACGGTACCTTACATTATTC
TCGAAAAATAGCTGCACGCTTTTCCAGGAATAAAAGACCGTGCCACTAATTTCACGTGAT
CAATATATTTACAAGCCACCTCAAAAAATGTGGCAATGGAGAAGAGGATGAACGACTCAA
TATGACTTCAACTTCATGAATTTGTCAAAATATCTATATAAGATGCAAAATTTCTATACA
ACATCAGTTGCGTATCCGTTAATGTCGTTCATTTTCTCTCTTTGTTCGAACTTGACATCA
AGAAAAGTTGGAATTATTTCTCCAAGCACACTGTACACCA
Chr coordinates Chr XI from 439385-438777
w3c xhtml validator w3c css validator