Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CAP1
Systematic Name YKL007W
Strain S288c
Description Alpha subunit of the capping protein heterodimer (Cap1p and Cap2p); capping protein (CP) binds to the barbed ends of actin filaments preventing further polymerization; localized predominantly to cortical actin patches; protein increases in abundance and relocalizes from bud neck to plasma membrane upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CAP1 YKL007W
AGGCATGACGGTAACTTATCTCTCGGAATGAAAACCAGATTTTCTTGACCAGGTCGCTAT
CATTTTTGGTGGCTTCAGATAATCTCTGCATACGCCTTTTAGCAGCCGTTTTAGATTCTT
TTGTCTCGAACATAGTACCTAAACTAGGTACAGTGTCCCCGAGGTCGATCTTACCTATGG
AAGACTTGCGTCTTGGTCTTGACCTCACTTTCAAATTGTTGTTTGAAGGGCTTGGCTTTA
TTGTCGACATAGCTCTTGTTTATTGATACTGTGTCTATCTAAATGTTTACCGGAGGTATG
AATAATAAAAACAATAGCGATCAACCGACAAAAATATCTGTATGGAACAGAAAAACGGTA
ACGAACAAGAAACTGTAGTTTTAACTTAAATCAGGTCCGGATTATAAAGCCGATGTAGCA
GAAAAACGGGTTCACGGAATACAATAGCCAAATAACAATAAATAAATAAATAAATAAATA
AGAAAAAAAAAAAGCAAGTAAATAAAACAAAACGGGATGCAACAAGCCAAGGAGGGAAAC
AATAGAAAAATAACTTAAAAATCTTTGTCTAGATTCCAATACTTTCTCCCTCCTCCCACG
TTATTTGTCTAGCATGATCAGGTACAATGCCCACCGATATGAGAAAAAAGAGTGAAAAAA
AAAAAATGACGAAAATGGTTCCGCGGATCTAGCAACTTTGTTGGAATGACCGGAAAAGAC
AGTTGTTTCCTTTCCAACTATTTTTCATTCCTGGTCTTTTTCCTGTTGAAGCCCAGCATT
TTTTTTTTCGCGTCGCGTTTTTTCACAACAGTTCGGATCACGTGATAATCACTGCACGTG
ACTATCATGTGATACGATAGCCGGGTTATGATCCCCTTTTTCTTCCTATTGGAATACTGA
TTTTACAGTGGCTAGTACTGGATTTGAGTATAGGAAGGTGTTAGCAACTGTAAGGTACTA
TTCAGACCGTTAATCCAACGGATCATAAGAGCGACAGAAA
Chr coordinates Chr XI from 429302-430108
w3c xhtml validator w3c css validator