Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRT4
Systematic Name YKL009W
Strain S288c
Description Protein involved in mRNA turnover and ribosome assembly; required at post-transcriptional step for efficient retrotransposition; localizes to the nucleolus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRT4 YKL009W
TAATTCTATCGACAACCATTTGATTCATCATTAATATGTTTTCAGAAAGTTCTTTTAAAC
TCTCCATTGCAATATAAGGATCCTCGGAGGCATTCCCAGTATTCTCTATCAATTTAGAAA
TCCGCTCATTCCTTGCCGAACTCTCTGCGCTCCTCTCCATCCTTCCTCCAATCATCGATA
AAATCTCGGGTAGTGTTCTTCCAACCGGGTGTTGCCCAAGTCCTTCACTTGTTTGTCTTC
TTTGTTCTAGTCTTTGTGCGAATGTTTCCAAAATGTCAGGTAAATGTAGGGGGTTGCTGC
CAAATTCATTATTATCGTGAGAACGTTCAAGTCCATCTTCTTCTTCATTTCTGTCTTCGT
CACTGCCATTCTGAGTTCTATGATATCCATATAAAAGTCCAGAATCATCTTCATGATGGT
AATCGTTATCGTCATCTTCACCATCATCTGCCTCAAAACTTCCGACGCTAGAAAGCATAT
GTTCATCTTCATCTTCATCAGGATAATAAGAGTACTCACCCTGTACATGGCCATCCTCAT
CATAGTCATCTTCTACCTGCGTATCCATCATATAATCACTGTTTTCGCTATGGGACTCAT
GTTCATCAAGGTTGTGCGAATTATTTTCAGACATGCTTGGCTACTCTTCTATTTTAAATG
TTTATCCAAAATTTTCACACCTGAGATATATTGTTGTTAATAAAGCACACAGAAAGGAAA
GTATCGATCCCAGAAAGTGGTCTTTCCCTGGGTATGATCAAAGCTATTCCCCTTTCCAAC
TACTGTTGGCTATGATCCCACAATTTGATTTCAGTTCAGAAAACCCAACCATTAGGACTT
TACCCGGCGAAGGTGAAAGAAAAAATTTTTTTCCAGAAAAATGCGATGAGCTTTTGAAAA
GTTGCAAATATTTGTAGTACTTTGGCTAAGCAGAGCTGATTCCTTTTGCTATACGTACAT
CACTGTCTATCGTCCATAAAAGATTTATTATAGTTGAATC
Chr coordinates Chr XI from 426242-426952
w3c xhtml validator w3c css validator