Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UFD4
Systematic Name YKL010C
Strain S288c
Description Ubiquitin-protein ligase (E3) that interacts with Rpt4p and Rpt6p, two subunits of the 19S particle of the 26S proteasome; cytoplasmic E3 involved in the degradation of ubiquitin fusion proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UFD4 YKL010C
CAGAAGCAGCGATACCGAATTGTTTCAGTATTAAAGCTTGACGAACATCTAATTTTTCTC
CTTCAGTGCAAACTAAATATGGACTGTCAATGGTGATCTTACCAGCTTTGATTTTAGTTG
GAATTTCAAATTTGTTTCTCATAGTTGGCTCTAAAGAATGAATCATTGGAACATCTTCCT
CAGCTGGAATTTGACCACCACGTGAGTAGACAATGCCCTCAGGAATTGTAAATGTTAGTG
GTGCTTTCGTGTTCGGTCTTGAATAGTCTGAACGAACGTATGACTTAAAGTATTCCTTGA
CAGTGTTGACATCCTCATCAGTGAACAATAAACCAGTGACACCGCTACAAAGCTTACTCA
ATTGATACAGATTTTCTTTGTATTCTTCTTCCCTCTTTTCTCCCAATGCTTTTTGTAAAA
CTTTCCTCTTACCCATAATTAACTTAGAGCCTGCCCAAGATGTTCTGATTTCTTGTAAAA
CTGGAGTTCTTACGTCGTCAAGATGTAGGACCCAGACGTATCTATAAGTATCTAAGGCTT
CCCTCACTTCATCGAAAATTCTTTCTTTATTTTCTCTGCCCTTTTTATCGGTTTGTGCTA
AAGTGACTAGCTTGGAACGTTTTGATCTTGGCATGATTCAACTATAATAAATCTTTTATG
GACGATAGACAGTGATGTACGTATAGCAAAAGGAATCAGCTCTGCTTAGCCAAAGTACTA
CAAATATTTGCAACTTTTCAAAAGCTCATCGCATTTTTCTGGAAAAAAATTTTTTCTTTC
ACCTTCGCCGGGTAAAGTCCTAATGGTTGGGTTTTCTGAACTGAAATCAAATTGTGGGAT
CATAGCCAACAGTAGTTGGAAAGGGGAATAGCTTTGATCATACCCAGGGAAAGACCACTT
TCTGGGATCGATACTTTCCTTTCTGTGTGCTTTATTAACAACAATATATCTCAGGTGTGA
AAATTTTGGATAAACATTTAAAATAGAAGAGTAGCCAAGC
Chr coordinates Chr XI from 425875-421424
w3c xhtml validator w3c css validator