Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATP7
Systematic Name YKL016C
Strain S288c
Description Subunit d of the stator stalk of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATP7 YKL016C
TTATCGGACGCAGTGTTACTATTGGACATGAGGTCAAATATAGGAGCCGCCGGAGCGCTG
GATACTTCCAATGTGTCACTTGAGGGTGCATTGTTTATATGCCTCTCGTCATCATCGCTG
TTATCCTTACCACGTACACTCACTGGTCTCTCCAAGAGCAAAGCTTTCAGGCGGTTATTC
TCTTCAGTTTTATCATTCAAGTCTTTTTGCAGTTGTTGCAGATACTTTGTCGACACAACA
ATTTTTTTTGACGGCTCCAAGTACTCACATATGGCATTGCTCGTAACACATTTTTGGCAA
GGGTTACCACCAGGACATTTTATATGACGTTTCCTACAAGAAAGGCATGCGACAGAAGAT
CTCTGCTGCCTTTTTTGCGGTTGTTTATTAACGTAGGCTGGTTGCTTAGATTGTATCGAA
TGCCTACTGCCTTGGTCGGTCACCATTAAACTCGTTAAGATCACTGCAATTATCCTATCA
ATGAGTTAGTTGGACCAGTGTCGTATTTATCGTTATTGTAATGGTTACTTACTAATTGCT
GCTTAGAAAGCTTTAAATTGCCGCCGAAGTCAAGTATATCATCAAGCACCTGGTGGATGT
TTTCATTTTTACTCCAATATTCGCCACCTCATTGCCGCGGAGAAATATCGTTTATAATGA
CATATCCGATGACTCAATCCCATAAACGAGGTATGGGTGTATATCACGTGATATATTATG
CTCACGTGATGACCACGTGACTAATGAGCGGGTTACAAGAATTATTTTCTCTTCGATTTG
ATTGGATATTTGTCTTGATGCCCCCAAAAAAGTAAAAGATACACCAATTACCACTTGCTG
CTTAGCGTAGGTGTAAAACATATTTCTACTAGTACAATACTTTTCTATATAAGTTTATAT
ATTCATATTGACACGTAACGCAAAAGAACAATCTTAGGATTTAAAAGAAATTTTTCGTGC
ACTTAATTGCAGAATCACCTAATTATATTTTTGTTCGACT
Chr coordinates Chr XI from 407989-407465
w3c xhtml validator w3c css validator