Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAE1
Systematic Name YKL029C
Strain S288c
Description Mitochondrial malic enzyme; catalyzes the oxidative decarboxylation of malate to pyruvate, which is a key intermediate in sugar metabolism and a precursor for synthesis of several amino acids
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>MAE1 YKL029C
ATGCTTAGAACCAGACTATCCGTTTCCGTTGCTGCTAGATCGCAACTAACCAGATCCTTG
ACAGCATCAAGGACAGCACCATTAAGAAGATGGCCTATTCAGCAATCGCGTTTATATTCT
TCTAACACTAGATCGCATAAAGCTACCACAACAAGAGAAAATACTTTCCAAAAGCCATAC
AGCGACGAGGAGGTCACTAAAACACCCGTCGGTTCTCGCGCCAGAAAGATCTTCGAAGCT
CCTCACCCACATGCCACTCGTTTGACTGTAGAAGGTGCCATAGAATGTCCCTTGGAGAGC
TTTCAACTTTTAAACTCTCCTTTATTTAACAAGGGTTCTGCATTTACACAAGAAGAAAGG
GAAGCGTTTAATTTAGAAGCATTGCTACCACCACAAGTGAACACTTTGGACGAACAACTG
GAAAGAAGCTACAAGCAGTTATGCTATTTGAAGACGCCCTTGGCCAAAAACGACTTCATG
ACGTCTTTGAGAGTACAGAACAAAGTCCTATATTTTGCATTAATAAGGAGACATATCAAG
GAATTAGTTCCTATCATTTACACCCCAACCGAAGGTGATGCTATTGCTGCCTATTCCCAC
AGGTTCAGAAAGCCAGAAGGTGTGTTTTTAGACATTACCGAACCTGATTCCATCGAATGT
AGATTGGCTACATACGGTGGAGACAAAGATGTAGACTACATCGTTGTGTCGGATTCGGAA
GGTATTCTGGGAATTGGTGACCAAGGTATCGGTGGTGTACGTATTGCTATCTCCAAATTG
GCATTGATGACGCTGTGCGGTGGTATTCATCCCGGCCGTGTGCTACCTGTGTGTTTGGAC
GTCGGTACTAACAACAAGAAACTAGCCCGTGACGAATTGTACATGGGTAACAAGTTCTCC
AGAATCAGGGGTAAGCAATATGACGACTTCTTGGAAAAATTCATCAAGGCCGTTAAGAAA
GTGTATCCAAGCGCCGTTCTGCATTTCGAAGATTTCGGTGTTAAGAACGCTAGAAGATTA
CTAGAAAAGTACAGGTACGAATTGCCATCATTCAACGATGACATTCAGGGCACCGGTGCC
GTCGTGATGGCCTCGTTGATTGCTGCTTTGAAACATACCAACAGAGACTTGAAAGACACC
AGAGTGCTTATTTACGGTGCCGGGTCTGCGGGCCTCGGTATCGCAGATCAAATTGTGAAT
CATATGGTCACGCACGGCGTTGACAAGGAAGAAGCGCGCAAGAAAATCTTCTTGATGGAC
AGACGTGGGTTAATTCTACAATCTTACGAGGCTAACTCCACTCCCGCCCAACACGTATAC
GCTAAGAGTGATGCGGAATGGGCTGGTATCAACACCCGCTCTTTACATGATGTGGTGGAG
AACGTCAAACCAACGTGTTTGGTTGGCTGCTCCACACAAGCAGGCGCATTCACTCAAGAT
GTCGTAGAAGAAATGCACAAGCACAATCCTAGACCGATCATTTTCCCATTATCCAACCCT
ACTAGACTACACGAAGCCGTTCCTGCCGATTTAATGAAGTGGACCAACAACAACGCTCTT
GTAGCTACCGGATCTCCTTTCCCACCTGTTGATGGTTACCGTATCTCGGAGAACAACAAT
TGTTACTCTTTCCCAGGTATCGGTTTAGGTGCCGTACTATCGCGTGCCACCACCATCACA
GACAAGATGATCTCCGCTGCAGTGGACCAACTAGCCGAATTGTCGCCACTAAGAGAGGGC
GACTCGAGACCTGGGTTGCTACCCGGCCTGGACACCATCACCAACACTTCTGCGCGTCTA
GCTACCGCTGTGATCTTGCAAGCACTCGAGGAGGGAACCGCCCGTATCGAGCAAGAACAA
GTACCGGGAGGAGCTCCCGGCGAAACTGTCAAGGTTCCTCGTGACTTTGACGAATGTTTA
CAGTGGGTCAAAGCCCAAATGTGGGAGCCTGTGTACAGACCTATGATCAAGGTCCAACAT
GACCCATCGGTGCACACCAACCAATTGTAG
Promoter Sequence
Download FASTA
>MAE1 YKL029C
TTTTCTATCTTTGGCTCGATTAGGACGAGCAATCATGCTGCCAAGTTTACACTTAATTAG
CTTTTTTCCTAATCTTGCAAGAACCGCTTAGATAATCACTACACACGGTAACGCTTAGTA
AAAAACCAAAAAAAAAAACCAAGTATTATTACGTATTAACTCACCAGACTACAATAGTAA
CCTGAAATTCGCCCATGGTACAATTTACACTTCCAAATTTTTTTGTTTTTTTATCATTTG
GACATCCTTTGCCCTTCACCCAGTGTCAATCATTACAACAATTATAGCGATTCATCACAG
TGCAAGGATCACTCTTAACGAAGGAAGAAAAGTTAGAAAAATTTCTCATATGTTTCGCGT
TTATTTTCGATACCAATTCGTTTCGATGTGTGCAAATTGAATATTGCATCGTGCATTGCA
AGGTTTTTCAAATTCTTGCGTCTTGTCAACCGTTCAAGGCGATTGAAAGATATTCACTGC
ATATCTTCTTATACGAAAAGCATCGAAGAAAAAACACCCATACAACCAAGTATAGACGGA
ACAATTCGGGTTTTTACTCTTCCCTAGGCGGTTTAAATCGGATATATGAAAAGAAATCAA
AAAAAAAAAAAAAAAAAAAAAAGAATTGGCGCATTTGAAGTTTTATTATCGTACGCGTTA
TTGTTTGCGCTAACATCGCATCGCATCAGCTGACTGAGTGACTGAGTCCCCTTGGCTTCG
ACTCATCATCGCCTTTCTATGGTGAAAAATTTTCGCAATTTCCTATTACTGTACCGCGTA
TGCTCCATTTGACTTCCTTTGGTCTACAGCTTTAGCGCTATAGAGTTTCGAAGTCGTACC
CGTTACCGGCATGATTGACATATTATATATATATATATATGCGTATCTTTATACTTACTC
GTATATTGTGTCCAGCTTCGGATATTTGTGCTTTTGAAACCTACAACTTTTAACGAGTTT
AGTGCACATAAATACCAAGACAAAAGGTAGAAATACGGTT
Chr coordinates Chr XI from 384725-382716
w3c xhtml validator w3c css validator