Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHD1
Systematic Name YKL043W
Strain S288c
Description Transcriptional activator that enhances pseudohyphal growth; physically interacts with the Tup1-Cyc8 complex and recruits Tup1p to its targets; regulates expression of FLO11, an adhesin required for pseudohyphal filament formation; similar to StuA, an A. nidulans developmental regulator; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHD1 YKL043W
GCTCCCTGATTAGACTTCGTGCGATATTATTGATGGATATCGTCTTTATCTTTCCGTGGA
CCTAAAACGGCACCCCTTCGTCTAGGATAAACGCGGTCGGCTCTTTCGAAGACTAAAAAA
GCAGCCACAATAACGTTACATGCAAAATCAGCCCACTCGAAGTTAGATACTGCGTAGACG
GATTTGCACGATGCGATGATAAATATTAGGGACAGTGCGTGCCCACCCATAAGTTGCTGT
AGAGCTTACAAATTGTAAAGACTAATTCCAATCGCACGCCCACCCCTCACGGGAATAAGT
TAGAATGTTGCGGAATGAACGATAACTTCATATTAGGTAAAAGGGAAGAATGCAACGCTG
CGGTCTACGGGCTTTTTTCTGCGAGACCAATTTTCTTCTTTTGTTTTTTTATTTCGATAT
TTAGTTTTCATGCAAACGGGTATTATTCTTGACAGGCCATTATGTAAGAGTGTGGAAACA
TAATTCTTGCACATACGACGTTTTCTTAACTGTTCCTGTTTCAAGTTACGGAAACGCCTG
TGGCCCAGGTAGCGTAGGCAAAATCAAGCTCAGAATGGGTTACGTAATTATGACGTTTTC
GAGTGCGAGGATGTCAGAAAGGAGAGCCAGAATTATATATATATGGATGCATCTCTCTGC
ATATAAAATTAATTTCCCTTTCGTACAGTTCCCTACTTTTTTTTCCCTCTTTCGTTTGCA
AAAGAAGGCGGCCATACTCATTAAAAACCCCTCCCCATTTTTCCTTTTTTTTTTGTTTCC
ATATAGGAAGAACTCTACAGCTCGAACAATACATCAAATCAATCAAGCAGTCGCTCTCGT
TCTATTGTGTGTTTCTCACCACCTTACATATCTCCCCTCAGTTCCCAGCCTATAACTTTG
TGGTTCTCTTCTTTTCAACTTCTTCTTCTTGACATTATACTTTAATAAGACCATTACTTC
TTTTTCTTTGCTGGAATTCATAATTCATTAAGCAGAAAAT
Chr coordinates Chr XI from 356748-357848
w3c xhtml validator w3c css validator