Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSN4
Systematic Name YKL062W
Strain S288c
Description Transcriptional activator related to Msn2p; activated in stress conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSN4 YKL062W
CACCCAGGACCTCTGAAGGCAAAGAAGTTGTGAAATTTGAAAAATAATCGCTCAAAAAGG
AATAATTGTCAAGCGTAACGATTTTTTTGATTTTCCGAAATCAGGGGAGGGGAAAAGAAA
AGGGGAAGGGGTCTCCTCACAGGTATTGTGAGCTCCAAGCAATCATTTTGCCAGCACTAG
GAAATAATAAAATGAAAGAAAAAAACATACATAGAAAGTGCCGCTCCGGGGCATTTTGAG
CGCGGCAAAAAAAGCCCGAAGATCCGTTCCTCGAAGGAACGGCAACCGCACACCAAGAAA
AAGGGAAAAAGGTGGGGTTGGCTGTAAAGTACGAGCGCGGGGACGGATCCGTAACAATTT
CTATGTGGGGCCAGCAGCCGGCTGCTGGTGGGTACTGTTGTACGAAGCGGTTGGTAGCGA
TGACAGTGGCCAGGGCTGCTAGGCATGGTGCCGTGAAAACCCAGCGCAAATGTCAGGCTG
CAGGAACCGGCTTTCTCCCACGAGGTTTCACTGCTGGCGGCGTACTGGTCATTTTTAGAA
CCTGAAAACCCGAGCTAGAACTAGGACTCTTGAGCAATAAGGTTTGCGCATTGCTATTCT
CCGGATAAACCAAACCCACCCTTTTAAGAGCGTTTAACAAAGGTCTCTTATCTATCAAAA
GTATTATGGCTATTTCTGGGATTCCGCTTGCGGGCCTTTCTACCCTCTTGATGCTACACA
TGTTTCCCTTAGATGCATGAGCATACCTGTAGGTACTTAAATTTTATTTTTATGCATCTT
ATTTCTGTCTAAATTTGTATATAACAAGCAACTGCAGTTCTGTGATGTGTTTTTCGCAAC
TGGTCAACAGGCTTAAGAATTTTTCCGTCTCTTTCCGTTTTATTTCCAGAGAATTAACAT
TTATAGAGAAAAGAATTAAAACGTGAAATTTCCTTTTTGAATATTTAACGCCTTTATCAG
TTCGGCTTTTTTTTCTTTTCTTCTTATTAAAAACAATATA
Chr coordinates Chr XI from 323228-325120
w3c xhtml validator w3c css validator