Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YET1
Systematic Name YKL065C
Strain S288c
Description Endoplasmic reticulum transmembrane protein; may interact with ribosomes, based on co-purification experiments; homolog of human BAP31 protein; YET1 has a paralog, YET2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YET1 YKL065C
GAACGCGCCCTTGAGCGATGGATCCTCACTTTTTATTATATCATTACTTGTAGAATCAGA
TTCATGCAGCATGCCCCAGGAATCGATCTGGTCGAAATCAGTAATCTGGCCGTGATTGTG
TTGCAGATTATCATGCAGCAGTTGCGTTGGCCTACGTGAGTCTGACTTCAAGTGACCAAC
AAACTTGTCCTTTCTTCTTTTTTGATTGCGCTTCTTTTTCCTTAGTTGAGGGCTACTAGA
GTAAGGGGAAAGCAAAGGAACACCTTCATCCTTTTGTGAGTTATCAGTGCTCATTTTTAA
TCTTTTTCTTCTCTACACTTCTCACTTTTATTCTCTCAATTTACTGTCGAAGTAAGGGGA
TAAACTCAGTGTAGCAATACGTACAACTTAGTCATCAAATGAAAAAATGCGGACTACCAA
ACCAGAAAATGATGAATAGTTATACAAGTATACGATAGTACAAAAATATATTTAAAGGGC
CAGGTACTACTAACGACAACCTGGGCTAGGTTTCACATATCAAAAAGAAGTTATGGCTTA
TGTGCTCTTTCTAAGTTTGACTTTATGCCAAAAATTTCTCCGTAGATCGCCGCCCGTTGA
AGCAGCAGAATATTTTAAGTGCGCCATAAAAACCTAGATAGAAAAGAAGGGAGAGAACAT
AAACGCAGAACACCACTACTTTTAAGGCGTACGCAAACTGTTGGGCTTATCTATATTGTA
CTATCTACCTACTTGCAACGTCTTTTACCTCCTCGATACGTACTGCTTATGCCCTGAACA
ATTTACATGTAACCCGCAGCTGCATGCTATATCACAGGATACGTTAACATAAAGGGGGCG
CTACTAAACCCTCTGGCGCAGTGCAAAAATAGAAATATATGCCAAGTGGGACCTTGTATA
GTTTCTGGTTTAAAGCTATTCGTTCATTGCAACGCTCCTTTCTGCTATCCTTTCGCAAAG
TGGCAAGTACTGAAAACCGAGAAGAATAAATAATATTGCG
Chr coordinates Chr XI from 317057-316437
w3c xhtml validator w3c css validator