Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VMA5
Systematic Name YKL080W
Alias CSL5, VAT3
Strain S288c
Description Subunit C of the eight-subunit V1 peripheral membrane domain of vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; required for the V1 domain to assemble onto the vacuolar membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VMA5 YKL080W
TACTCCAACGACGACACCAGACCAGTTGCTTTGCCATGGTTCTGGGAACACTACAACCCT
GAAGAATACTCCATCTGGAAGGTTGGTTACAAATACAACGACGAACTTACCTTGACTTTC
ATGTCCAACAACTTGGTCGGTGGTTTTTTCAACAGATTGTCCGCTTCTACTAAGTACATG
TTCGGTTGTTTAGTTGTCTATGGTGAAAACAACAATAATGGTATTGTTGGTGCCGTTATG
GTCAGAGGCCAAGATTTCGCTCCAGCCTTTGATGTCGCTCCAGACTGGGAATCTTACGAA
TACACCAAGTTGGACCCAACCAAGGAAGAAGACAAAGAATTTGTCAACAACATGTGGGCT
TGGGATAAGCCTGTTGTTGTCAATGGCGAAGATAAGGAAATTGTTGACGGTAAGGTTTTG
AAATAATCTCAATAACTCTTCTTCCATATTTTCTTCCCAATATACATAAGAGTCAAACAA
AACGAATTTTCAAAAGAAAAAAGAAAAAAACCCTGAAGTCTACTTCATGATTACCCCATA
CTTACGCGTGGTTTAATTCTATGTAACGATTAACGTCCATGTAATCATTATATATATATA
TATTGTAATAATCTCTCTAATTGAGTATCACAATCTGCTGCGGTTACTCTAACAATATTT
TGCATAAACTTGATTCTTCTCTTCTTATTTCATGTTTCAGTGGGGCATTTTCCATTGTAC
TTTTGCAACAATAGCGAAAAAAACAATTTTCCGTAAAGAGAAGCGTCAGTCATAAACGGT
GTATGTTACCCGAACTGGAATGAATTTTATCTTAAGACTGGAAAACAATTTAGGATAGAA
CTGAAGATAGTGCAACACGTCTGGTGATATCATGTGCTTTCAAGCAGGATTTGTCACAGT
GCTTTAGAAACACAAACAAAGGAGGTATATAGAAGTTGCAGTTGCTAGAGTTTGTTTTCT
TACCTAATTCTAGATCAATTCTTTTTTCTGAAAAAAAAAA
Chr coordinates Chr XI from 285030-286208
w3c xhtml validator w3c css validator