Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRX1
Systematic Name YKL086W
Alias sulfiredoxin
Strain S288c
Description Sulfiredoxin, contributes to oxidative stress resistance by reducing cysteine-sulfinic acid groups in the peroxiredoxin Tsa1p, which is formed upon exposure to oxidants; conserved in higher eukaryotes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRX1 YKL086W
GCGAGTTTGCATCGTTCAGATCGGTGGAATAGAAATCGATTACGTAGTCGACGGTTTTAC
CGCATCTATCTATCTGCCAATCATGTCTATCAAAAGGTTTGGCCAGGTGCAAGATACGGG
ACCTGAACCAGGCCCTTGGTGTCAGTTTTTTGGAATCACCTTTAAAATTTGTTAATTTGA
TACCGCCACACGCTTCACCACCCTGCTTGTCTTCCCAGCTTTTAATGTAGTTCCAAACCC
GCTCATTGATGGAGTTATGTAAAGGCACAACCACCTTCATGTCATCTGAGTTCGGATCCC
AATTTTTTTTCATCATTGCCTCGTAAAATTGTTTCTCCGACGGGTATATCCAGTTTCTGT
CAGAATTCGTCCTTGGTATGGTGGAAACCTCTCTGGACTGAGAGAGATCCACCGTGGTGT
GATATTCAGGCGTTTTATCGTTATCTTGTGGGTTTGCAGAGCACTCTAGTTGATTGCCTG
GGGCAGTAGCACCAGGATGCGCTTCGTTGCCATGTTCTCGTAGCCATAACTTTTTGGTTT
CCTCATCTACGGGGCATTTCCCCTGTTGGTCTGAAGACATCATAATATGTAAAATAGAGA
CGAATGAAAAGCACGTGAACTAACAAACTATTTACTACTACCGAAATGTGATGCTTAAGC
CTTTGGCCTCTGCAATACTAGCGATTGCTTTTTCCCTGATTAGTAAGCTACATCATTTAT
ACTACATCTTTCTGTCTTAGAAGGCTTACAAACATCGAAAAGCTGGAACTTTGATTTCGA
AAAAAATATGCCGTTACCCGTTGCGGGTCCCTTTTTTTTAGAAGGCCGGCCCAGAAGTCG
CCATTATTTTTAGTCATTACAGTAGCCCTGTTGGGTAAGGATGCGATGCAATACATGTCA
AGAGGTGTTGTATATAAACCACAATATCTACCATCAATGAGCTATATATACTTTTCTTAC
TGAAAAAAAAAACTACAAAACCAAGTAAAAAAAGAACAAT
Chr coordinates Chr XI from 278281-278664
w3c xhtml validator w3c css validator