Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YJU3
Systematic Name YKL094W
Strain S288c
Description Monoglyceride lipase (MGL), functional ortholog of mammalian MGL, localizes to lipid particles and membranes, also member of the eukaryotic serine hydrolase family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YJU3 YKL094W
AGGAAAATGGCTAAAAAACTGAAAACCATGAATAAGAGCCACGCATCGATTAGATTAATG
ACCCCATTTAGTATGAGGTGTTTGGAATGTAACGAATATATTCCCAAAAGCAGAAAATTC
AATGGTAAGAAAGAGCTACTGAAGGAGAAGTACCTGGACTCCATTAAGATATATAGACTA
ACCATTTCATGTCCACGTTGTGCCAATTCCATTGCATTTAGAACAGACCCCGGTAATTCA
GATTATGTAATGGAAGTGGGGGGCGTAAGAAACTATGTCCCTCAGAAACCAAATGATGAC
CTGAACGCTAAAACAGCTGTCGAAAGCATAGACGAGACACTGCAACGCTTAGTGAGAGAG
AAGGAAATGGAGCAGAACGAGAAGATGGGTATAAAGGAGCAAGCAGATGACAAAATGGAT
TTGCTGGAAAAAAGACTAGCCAAAATTCAACAAGAGCAAGAGGATGATGAGGAACTTGAA
AATTTAAGGAAAAAAAACCTTGAAATGAGCCAGAGAGCTGAAATGATAAACCGCAGCAAA
CACGCACAACAAGAAAAAGCAGTAACGACTGATGATCTGGACAACCTCGTAGATCAGGTA
TTTGACAATCACAGGCAGCGTACCAATAAACCTGGCAATAACAACGATGAGAAGAGAACT
CCGTTGTTTAATCCTACATCCACTAAGGGAAAAATACAGAAGAAAAGCTCTGTGCGTACG
AATCCGTTAGGGATAGTTATAAAACGAGGAAAGTCTCTCAAATGACCTAGAAAAGTAAGG
AACGTACGATTGGTATCATGATCTCTTGTGATGCTGTGCTACTGTGGTTGCTTCCACACT
ATAGCGTCCATCGCTACTTACGAGGGGCGACAGCCCCTTCGGACTTCGAAGTGTCTGGCC
GTTTTTTCATTGAATTTTCTTATAAATGAATACATATCGGAAAAGCCATTGTTGACTAAA
GCAAGCCAAAGCCACACAAACCGAGGACAAATAGAAAAGC
Chr coordinates Chr XI from 263349-264290
w3c xhtml validator w3c css validator