Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CWP1
Systematic Name YKL096W
Alias YJU1
Strain S288c
Description Cell wall mannoprotein that localizes specifically to birth scars of daughter cells, linked to a beta-1,3- and beta-1,6-glucan heteropolymer through a phosphodiester bond; required for propionic acid resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CWP1 YKL096W
TCCTCACTACAATTGCCCCTCGGATGGATTTGAACTTACAAGAAATATCACGTTGGCGCG
CGCTAAAGTCGCTTGCCAATGCGCTATGAAATTTTCATGACCTGGCACATTTTAGCACAG
TGCCATTAATCCCTTTATTATGGGCATTGATGCGACTTTAAAACTGTACCTTCCTTCGCA
CATGCTGAATTTTCTTAATGAGATTCATCTACGATGCTTTAGAGCTAGCCTTGTTTTCTT
TTTTATGCTTCAAGAGTAAGTAGTGAAGAACCCCACTAGACAAATACTAAGGGATGCTGC
AACCACGTCTTATACTTCACCCATACATAACATTGGAATCTCATTAATTTTTGCAAAGAT
ATGGTGAACAAGTTTCAAAATAAGAATGTATGTGTACCGAATCGTAGCTCGAGGTAATAA
TGAAAAAAAAAATCGGACATCTGGAAAGTTACGAATATAGAAGCAGATACCCCTCTTGAC
GGCAAACATTGTGTGCTCGACCTTCTATCCCGTTAAAATATCATAATAAACAAACCCCTC
CCGCGAAAACAAAAAAAGAGAGCTAAAAAAAGTACTTCTTCGCGTTATAGATGGTGCCGC
ACCGTACGTCATAACTAAAAATAGCGTTAGCCACAGCTCCCTGAACGAAAAGGGCCCTTC
GGCCCGATTGGAATACGGGTCCGCTTACGTCTGTGCGTGCGGGTTGTCCCACAACGGTAA
CTTACTCCAGGAGAGCCATCTCGAAGGTGCCACAAAAGAAAACAAAAAAAACAACAAACA
ATAAGCTCTGTGGTTCACGTTCAATGTAGTGTTTTTTCACCTTTTAATTTTGATAATTTG
TGGTGCAGAAAAAAAAAAAGCAAACAAACAAAATCTCAATTATTTAAAGGACGATCTTAA
CGTTTCTTTCTTTCGCTATCTTCCTTGAATTTTTTTTCTGTCTGAAGTAAAATATCCCGT
AACAAACTAATAAATACTACGAAAGTCTCAAAAAACAATA
Chr coordinates Chr XI from 261132-261851
w3c xhtml validator w3c css validator